ID: 1126938949

View in Genome Browser
Species Human (GRCh38)
Location 15:53744562-53744584
Sequence CTATGGTTTAGGAGGTGATT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 166}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126938949_1126938957 1 Left 1126938949 15:53744562-53744584 CCCAATCACCTCCTAAACCATAG 0: 1
1: 0
2: 0
3: 9
4: 166
Right 1126938957 15:53744586-53744608 GCCTCTCAAATCACCAGCATGGG 0: 1
1: 0
2: 0
3: 8
4: 113
1126938949_1126938959 2 Left 1126938949 15:53744562-53744584 CCCAATCACCTCCTAAACCATAG 0: 1
1: 0
2: 0
3: 9
4: 166
Right 1126938959 15:53744587-53744609 CCTCTCAAATCACCAGCATGGGG 0: 1
1: 1
2: 0
3: 9
4: 141
1126938949_1126938956 0 Left 1126938949 15:53744562-53744584 CCCAATCACCTCCTAAACCATAG 0: 1
1: 0
2: 0
3: 9
4: 166
Right 1126938956 15:53744585-53744607 GGCCTCTCAAATCACCAGCATGG 0: 1
1: 0
2: 1
3: 6
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126938949 Original CRISPR CTATGGTTTAGGAGGTGATT GGG (reversed) Intronic
900323260 1:2095308-2095330 CCATGGTTTTGGAGGTGGCTGGG + Intronic
904659944 1:32076833-32076855 CCATCGTGAAGGAGGTGATTGGG + Exonic
905776409 1:40670262-40670284 CAATTATTTAGGGGGTGATTTGG - Intergenic
906072019 1:43023977-43023999 TTTTGGTTAAGAAGGTGATTTGG + Intergenic
906426946 1:45722955-45722977 CTAGGGTTTAGGAGGAGAGATGG + Intronic
908033334 1:60025281-60025303 GACTGGTTTGGGAGGTGATTAGG - Intronic
908095412 1:60732303-60732325 CTATGGTTTATAAGGTGCTGTGG - Intergenic
908297257 1:62725139-62725161 ATTTGGTTTAGTAGGTAATTTGG - Intergenic
911425592 1:97707140-97707162 TCATGACTTAGGAGGTGATTAGG + Intronic
912525613 1:110280585-110280607 CGATGGTGTAGCAGGAGATTAGG - Intronic
914352820 1:146855077-146855099 CTGTGGTTAAGGAGGTGGTCAGG - Intergenic
915083910 1:153371425-153371447 TTGGGGTTTAGGAGGTGATTAGG - Intergenic
918683098 1:187379625-187379647 CTGTGGCTTAGTAAGTGATTAGG - Intergenic
919978942 1:202630483-202630505 CCAAGGTTTAGGAGGAGATGGGG + Intronic
920587529 1:207181549-207181571 CTATGGATTATGAGTTGAGTTGG - Intergenic
922938449 1:229439018-229439040 CTTTGGAGTGGGAGGTGATTAGG + Intergenic
1068980119 10:63053405-63053427 CTATAGGTTAGGAGATGATAGGG - Intergenic
1071788006 10:88924602-88924624 CTATGATTTAAGATGAGATTTGG - Intronic
1072205083 10:93196571-93196593 GTATGGTTTGGGAGGTGTCTTGG - Intergenic
1072832980 10:98678898-98678920 CTATTGTTTTGGTGGTGTTTAGG - Intronic
1074850181 10:117433126-117433148 CTTTGGTTTAGGGGGTGAGAAGG + Intergenic
1075333326 10:121591117-121591139 CTTTGGTGTCAGAGGTGATTAGG - Intronic
1081790136 11:45776601-45776623 TGGTGGTTTAGAAGGTGATTTGG - Intergenic
1082255739 11:50030290-50030312 CTATTGTTTAGGATAAGATTTGG - Intergenic
1082761414 11:57130574-57130596 CTTTGGTACAGAAGGTGATTTGG + Intergenic
1087702396 11:101450189-101450211 CTATGGGTTAAGAGAGGATTTGG - Intergenic
1087840676 11:102917826-102917848 TTGGGGATTAGGAGGTGATTCGG + Intergenic
1089032907 11:115351896-115351918 CTATGGTTTAAGTGGTGGTGAGG - Intronic
1092556076 12:9563402-9563424 CTATGGATTGGGAGGTGGCTAGG - Intergenic
1093605118 12:21079483-21079505 CTATAGTTTAAGATGAGATTTGG + Intronic
1094516017 12:31127246-31127268 CTATGGATTGGGAGGTGGCTAGG + Intergenic
1095826265 12:46532491-46532513 CTATGTTTTAGGGGGTGAGAAGG + Intergenic
1097616785 12:61893191-61893213 CTATGGCTTAGGGGTTGAATAGG + Intronic
1098035034 12:66293015-66293037 ATATCATTTAAGAGGTGATTGGG - Intergenic
1098503223 12:71218990-71219012 CTATGGTTTAGGGAGCCATTAGG - Intronic
1098989527 12:77049316-77049338 CTATGGTTTGGGGGCCGATTTGG - Intronic
1100352122 12:93794620-93794642 AGATGGATTAGGAGGTGATATGG - Intronic
1100613970 12:96216472-96216494 CTGTGGTTTATAAGGTGACTTGG - Intronic
1103192404 12:119012892-119012914 CTAAGGTTTAGAGGGTAATTGGG - Intronic
1111178305 13:84627843-84627865 CTATGGTTCAGAAGGGAATTGGG + Intergenic
1111739965 13:92192070-92192092 CTAAGGGTTAGGAGGTGAAGGGG + Intronic
1112132307 13:96537394-96537416 CTCAGGTATAGGAGGTGATATGG - Intronic
1113218874 13:108074796-108074818 CTATCGTTTAAGATGAGATTTGG + Intergenic
1115642848 14:35346064-35346086 ATATGGTTAAGAAAGTGATTAGG - Intergenic
1116747664 14:48842487-48842509 ATATCGTTTAAGAGTTGATTAGG + Intergenic
1121789996 14:96691924-96691946 TAAGGGTTTAAGAGGTGATTAGG - Intergenic
1121902425 14:97706222-97706244 CTGTGGTCTAGGAGGAGATTGGG + Intergenic
1122903949 14:104793419-104793441 CTGTGGTTTAGGAGGGGCCTGGG - Exonic
1124494539 15:30178371-30178393 CCAAGGTTTAGGAGGAGATGGGG + Intergenic
1124698310 15:31887060-31887082 CTATGGTTTTGTAGGTTGTTTGG + Intergenic
1124749031 15:32360274-32360296 CCAAGGTTTAGGAGGAGATGGGG - Intergenic
1126938949 15:53744562-53744584 CTATGGTTTAGGAGGTGATTGGG - Intronic
1129731265 15:77934036-77934058 CTATGTTTGGGGAGGTGACTGGG + Intergenic
1133066381 16:3210345-3210367 CTTTGGTTATGGAGGTGATGTGG + Intergenic
1133505462 16:6407948-6407970 GGAGGCTTTAGGAGGTGATTAGG + Intronic
1135499170 16:22978901-22978923 CCAAGCTTCAGGAGGTGATTAGG - Intergenic
1136418419 16:30117286-30117308 CTGTGGATAAGGAGGTGACTTGG + Intronic
1139320751 16:66111913-66111935 CAGGGCTTTAGGAGGTGATTAGG + Intergenic
1139981206 16:70860441-70860463 CTGTGGTTAAGGAGGTGGTCAGG + Intronic
1142162145 16:88563282-88563304 ATATGCTTTTGGAGGTAATTAGG - Intergenic
1149156429 17:53635635-53635657 CTATGGGTTGGGAGGTCATGAGG - Intergenic
1150963817 17:69944815-69944837 TTATGGTTAAGGAGGTTTTTGGG - Intergenic
1158914615 18:62110469-62110491 CTCTGTTTTGGCAGGTGATTGGG - Intronic
1160886617 19:1352725-1352747 CTGTGCTTTGGGAGGTGCTTTGG - Intergenic
1164505157 19:28854173-28854195 GAATTCTTTAGGAGGTGATTAGG + Intergenic
1167524005 19:49972559-49972581 GTGTGGTTTAGAAGGTGAATGGG + Intergenic
1167719872 19:51172022-51172044 TTGTGGTTTAGCAGGTGAATGGG + Intergenic
1168397764 19:56063631-56063653 ATAGGGTTTACGAGGTGAATGGG + Intergenic
925473897 2:4191896-4191918 CTATAGTTTAAGATGAGATTTGG + Intergenic
927843295 2:26458428-26458450 CTAGGCCTTAGGAGGAGATTCGG - Intronic
928055103 2:28044669-28044691 CTATGTTTTAAGATGTGTTTAGG + Intronic
929468030 2:42163567-42163589 CTGTGGTTTAGGAGCGGGTTGGG - Intergenic
929850973 2:45590407-45590429 TTATGGTTCAGGAGTTGATATGG + Intronic
930239411 2:48920861-48920883 AAAGGCTTTAGGAGGTGATTAGG - Intergenic
931461028 2:62450260-62450282 CTATGGGTTAGGCGTTGTTTGGG + Intergenic
934163347 2:89272707-89272729 CTAGGGTTAAAGAGGTGATCAGG - Intergenic
934203927 2:89909817-89909839 CTAGGGTTAAAGAGGTGATCAGG + Intergenic
936867293 2:117088997-117089019 CTAGGGTTTGGGAGTTGTTTGGG + Intergenic
940739428 2:157490311-157490333 CTATGGTTAATGAGGAGAGTTGG + Intergenic
941835030 2:170006804-170006826 CTATGATGTAAGAAGTGATTTGG + Intronic
942124210 2:172807144-172807166 CTATTTGTTAGGAGCTGATTGGG + Intronic
944937800 2:204587740-204587762 CTATAGTTCAGGATGAGATTTGG - Intronic
945438268 2:209845012-209845034 GGAGGCTTTAGGAGGTGATTAGG + Intronic
946710221 2:222497800-222497822 CTACTGTTTAGGATGTGATGAGG + Intronic
1170328631 20:15183752-15183774 CTTTTGTTCAGGATGTGATTGGG - Intronic
1172976304 20:38908388-38908410 CTGTAGTTAAGGAGGTGATCGGG + Intronic
1176943934 21:14956087-14956109 GTATGGTTCAGCAGGTAATTAGG + Intergenic
1178042673 21:28657321-28657343 CTATTATTTAGGAGCTGATCAGG - Intergenic
1178908593 21:36655970-36655992 CCAGGGTTGAGGAGGTGATAAGG - Intergenic
1179226403 21:39457571-39457593 ATTTGGTCTTGGAGGTGATTTGG + Intronic
1181870078 22:25891117-25891139 CTTTGGCCTTGGAGGTGATTTGG + Intronic
1184743298 22:46441713-46441735 GGGTGCTTTAGGAGGTGATTAGG - Intronic
949672973 3:6421477-6421499 CTAAGGTATTTGAGGTGATTTGG - Intergenic
949801820 3:7912495-7912517 CTCTGGTTTTGGGGGTGATAGGG - Intergenic
950107815 3:10399272-10399294 CTATGTTCTAAGAGGTCATTTGG + Intronic
950329816 3:12147372-12147394 CCATGGTTAAGGAGGGGGTTGGG + Intronic
951147259 3:19242561-19242583 CTATGGTTTAGGGGGAGAGGGGG - Intronic
952595527 3:35013454-35013476 TTATAGTTTAGTAGGTTATTAGG + Intergenic
955513242 3:59701810-59701832 TAATGGTTTAGGAGGAAATTTGG + Intergenic
956498523 3:69855162-69855184 CTCTGGATTAGGAGGGGTTTAGG - Intronic
956879850 3:73499473-73499495 ATATGTTTTAGGTGGTGAGTTGG - Intronic
961188777 3:124939820-124939842 CCATGATTTAGGAGGAGACTGGG + Intronic
965364159 3:167777843-167777865 GTAGGGCTTTGGAGGTGATTGGG + Intronic
965815894 3:172636476-172636498 CTCTGGGTTACGAGGTGACTTGG + Intronic
969887789 4:10231680-10231702 GGATCCTTTAGGAGGTGATTAGG - Intergenic
973904028 4:55508491-55508513 CTATGGTTTAAGAGATGAATTGG - Intronic
973966544 4:56168866-56168888 CTATGGATGAGTAGGTGAATGGG + Intergenic
978809516 4:112835081-112835103 CTAAGATTTAGGAGAGGATTTGG + Intronic
980557610 4:134430281-134430303 CACTGGTGTAGGAGGTAATTTGG + Intergenic
981681779 4:147407835-147407857 CTGTGGTTTAGGAGGTGGGGAGG - Intergenic
982338050 4:154261790-154261812 CTATGGTTTGTGAAGTAATTTGG - Intronic
986278911 5:6306518-6306540 CTATGGTTTATTAGGAGATGGGG + Intergenic
987603336 5:20101678-20101700 CTATGGTTTAGTCTGTGTTTGGG - Intronic
987901853 5:24023101-24023123 CTATGGGGGAGGAGGTGAATGGG + Intronic
988105622 5:26742753-26742775 CTATGGTTTGGGAGGGCATTAGG - Intergenic
989206899 5:38818648-38818670 CTGTATTTTAGGAGGAGATTTGG - Intergenic
990324083 5:54657491-54657513 CTAGGGTTTTGGATATGATTTGG - Intergenic
992378376 5:76212233-76212255 CTATGTTTAAGAAGGTGAATAGG + Intronic
993514489 5:88813803-88813825 CTTTGTTTTAGGATGTGTTTGGG + Intronic
994950562 5:106456155-106456177 CTATAGCTTCAGAGGTGATTAGG + Intergenic
995459621 5:112389081-112389103 CTATGGCTTAGCAGAAGATTCGG + Intronic
999447642 5:151653132-151653154 ATATCCTTTAGGAGGTGATGGGG - Intergenic
999908958 5:156175443-156175465 ATATGGTGTAGTTGGTGATTTGG - Intronic
1000205633 5:159055748-159055770 CAATGGATTTGGTGGTGATTTGG + Intronic
1002081530 5:176740488-176740510 CTAGGGTTCAGGAGAGGATTTGG - Intergenic
1002656125 5:180748906-180748928 CTAAGGGTCAGGAGGTGGTTTGG - Intergenic
1003765676 6:9233696-9233718 CTCTGGATCAGGAGGTCATTAGG + Intergenic
1008525810 6:52405513-52405535 CTATGGGATAGGTGGTGCTTGGG + Exonic
1010160424 6:72847469-72847491 ATATGGTTGTGGTGGTGATTGGG + Intronic
1012557070 6:100526642-100526664 CTTTGTTTTAGGTGGTGTTTTGG + Intronic
1013336898 6:109172666-109172688 CCATGCTTTAGGAGGAAATTTGG - Intergenic
1016059457 6:139614659-139614681 CTATGGCTTTGGAGGTTACTGGG - Intergenic
1016302443 6:142647292-142647314 CTATGGCTCAGGAGGGCATTTGG + Intergenic
1022271756 7:28814814-28814836 CTATGGCTTATGTGGTTATTAGG + Intronic
1022478344 7:30726640-30726662 CCATGGTGTAGGCGGTGATTGGG + Intronic
1024685105 7:51736236-51736258 CTATGGTTCAAGATGAGATTTGG - Intergenic
1026401306 7:70016411-70016433 TGATGGTTTAGGAGGAGATTTGG + Intronic
1027537966 7:79430617-79430639 CGGTGGTTTTGGAGATGATTAGG - Intronic
1027854946 7:83499362-83499384 ATATGGTTTATGAGGTTATGGGG - Intronic
1029937671 7:104444650-104444672 CCATGGTTTAGAAGCTGATTTGG + Intronic
1030903565 7:115154006-115154028 CTCTGCTCTAGGAAGTGATTAGG - Intergenic
1032341960 7:131082319-131082341 CCATGGTTTGGGATATGATTAGG - Intergenic
1032984055 7:137317368-137317390 TTATGATTTTGGAGGTGGTTGGG - Intronic
1033854229 7:145537664-145537686 CTTTGTTTTAGGAGATGATAAGG + Intergenic
1036998191 8:13684982-13685004 CTATGGTTGATGAGTTGATGTGG + Intergenic
1037152830 8:15658040-15658062 GGAAGCTTTAGGAGGTGATTAGG - Intronic
1037388722 8:18369801-18369823 ATATGGTATAGGAGGGGATCCGG - Intergenic
1040007731 8:42634547-42634569 CTATGGGTTAAGGGGTGAATGGG - Intergenic
1040972561 8:53152892-53152914 CTATGGTTCAAGATGAGATTTGG - Intergenic
1041862228 8:62527424-62527446 ATATGGTTTATGAGGTTATCTGG - Intronic
1042819425 8:72914218-72914240 GAATGCTTTGGGAGGTGATTAGG - Intronic
1044604642 8:94038110-94038132 CTATGGTAGAGGGGGTGAGTAGG + Intergenic
1045750460 8:105477673-105477695 CTATGTTTTAGGAGAAGATATGG - Intronic
1048022274 8:130550197-130550219 GTGAGGTTTAGGAGGTGATCAGG + Intergenic
1048078962 8:131103729-131103751 CTATGCTGTAGTAGATGATTTGG - Intergenic
1048484302 8:134832537-134832559 CTGGGGTTTGGGAGGTAATTTGG + Intergenic
1048776709 8:137954522-137954544 CTACGGTTCAGGATGAGATTTGG + Intergenic
1049021664 8:139961408-139961430 CTATGGTTTGGGTGGTGGTTTGG - Intronic
1049056762 8:140242985-140243007 CCATGGTTTAGAAGAGGATTTGG + Intronic
1049080528 8:140439762-140439784 CTTTGGTTTCTGAGTTGATTAGG - Intronic
1052024417 9:23558761-23558783 CTTTACTTTAGGAGGTGAATAGG + Intergenic
1052538186 9:29774858-29774880 CTATTGTTTAAGAGCTGATAGGG + Intergenic
1053376891 9:37615023-37615045 CTCTGGTTAAGAAGGAGATTTGG - Intronic
1055287331 9:74742890-74742912 GTATGGATTAGTATGTGATTTGG - Intronic
1057821996 9:98339581-98339603 TGATGGATTAGGATGTGATTTGG + Intronic
1058292544 9:103259980-103260002 CTATGGTTCAGGAGGATATTTGG + Intergenic
1058483774 9:105422935-105422957 CTAGGGGTTAGGAGATGATCGGG - Intronic
1060534468 9:124373182-124373204 TTATGGTTCAGTGGGTGATTCGG - Intronic
1192118327 X:68432472-68432494 CAATTGTTTAGGAGGTGCTGGGG + Intronic
1196459208 X:115912308-115912330 CTCTGTCTTGGGAGGTGATTTGG - Intergenic
1198863230 X:141092683-141092705 CAATTGTTTGGGAGGTGATATGG - Intergenic
1198899460 X:141494704-141494726 CAATTGTTTGGGAGGTGATATGG + Intergenic
1201754017 Y:17467291-17467313 CTATGGTTAAGGTTATGATTAGG + Intergenic
1201847535 Y:18438694-18438716 CTATGGTTAAGGTTATGATTAGG - Intergenic
1201861020 Y:18597342-18597364 TTATGCCCTAGGAGGTGATTAGG + Intergenic
1201872303 Y:18723038-18723060 TTATGCCCTAGGAGGTGATTAGG - Intergenic