ID: 1126942134

View in Genome Browser
Species Human (GRCh38)
Location 15:53778846-53778868
Sequence CCTCCAGTCCTGTAGTTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126942126_1126942134 3 Left 1126942126 15:53778820-53778842 CCATGAAGCCATTTTTCCCTCTT 0: 2
1: 19
2: 180
3: 686
4: 1777
Right 1126942134 15:53778846-53778868 CCTCCAGTCCTGTAGTTGGAGGG No data
1126942123_1126942134 15 Left 1126942123 15:53778808-53778830 CCTGAGCCTCGCCCATGAAGCCA No data
Right 1126942134 15:53778846-53778868 CCTCCAGTCCTGTAGTTGGAGGG No data
1126942128_1126942134 -5 Left 1126942128 15:53778828-53778850 CCATTTTTCCCTCTTAGGCCTCC 0: 7
1: 189
2: 588
3: 1127
4: 1657
Right 1126942134 15:53778846-53778868 CCTCCAGTCCTGTAGTTGGAGGG No data
1126942125_1126942134 4 Left 1126942125 15:53778819-53778841 CCCATGAAGCCATTTTTCCCTCT 0: 2
1: 15
2: 185
3: 654
4: 1546
Right 1126942134 15:53778846-53778868 CCTCCAGTCCTGTAGTTGGAGGG No data
1126942122_1126942134 16 Left 1126942122 15:53778807-53778829 CCCTGAGCCTCGCCCATGAAGCC No data
Right 1126942134 15:53778846-53778868 CCTCCAGTCCTGTAGTTGGAGGG No data
1126942124_1126942134 9 Left 1126942124 15:53778814-53778836 CCTCGCCCATGAAGCCATTTTTC No data
Right 1126942134 15:53778846-53778868 CCTCCAGTCCTGTAGTTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126942134 Original CRISPR CCTCCAGTCCTGTAGTTGGA GGG Intergenic
No off target data available for this crispr