ID: 1126942386

View in Genome Browser
Species Human (GRCh38)
Location 15:53780869-53780891
Sequence GGGCACGTTAATGCAAAAGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126942380_1126942386 14 Left 1126942380 15:53780832-53780854 CCAAAATGATCTCTTTTGACTCC 0: 91
1: 1431
2: 1953
3: 1485
4: 1058
Right 1126942386 15:53780869-53780891 GGGCACGTTAATGCAAAAGGCGG No data
1126942379_1126942386 24 Left 1126942379 15:53780822-53780844 CCTTAAAGTTCCAAAATGATCTC 0: 222
1: 344
2: 277
3: 207
4: 372
Right 1126942386 15:53780869-53780891 GGGCACGTTAATGCAAAAGGCGG No data
1126942383_1126942386 -7 Left 1126942383 15:53780853-53780875 CCGTGTCACACATCCAGGGCACG No data
Right 1126942386 15:53780869-53780891 GGGCACGTTAATGCAAAAGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126942386 Original CRISPR GGGCACGTTAATGCAAAAGG CGG Intergenic
No off target data available for this crispr