ID: 1126942397

View in Genome Browser
Species Human (GRCh38)
Location 15:53780941-53780963
Sequence CTGTGAAAGCAGCTGGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126942397_1126942403 18 Left 1126942397 15:53780941-53780963 CCTTCTTCCAGCTGCTTTCACAG No data
Right 1126942403 15:53780982-53781004 TGGCTTTTCCAGGCACATAACGG No data
1126942397_1126942402 8 Left 1126942397 15:53780941-53780963 CCTTCTTCCAGCTGCTTTCACAG No data
Right 1126942402 15:53780972-53780994 TGAGTTTCTGTGGCTTTTCCAGG 0: 19
1: 917
2: 1275
3: 1711
4: 1795
1126942397_1126942405 28 Left 1126942397 15:53780941-53780963 CCTTCTTCCAGCTGCTTTCACAG No data
Right 1126942405 15:53780992-53781014 AGGCACATAACGGAAGCTGTAGG No data
1126942397_1126942401 -2 Left 1126942397 15:53780941-53780963 CCTTCTTCCAGCTGCTTTCACAG No data
Right 1126942401 15:53780962-53780984 AGGCTGGCATTGAGTTTCTGTGG 0: 6
1: 198
2: 627
3: 920
4: 1184

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126942397 Original CRISPR CTGTGAAAGCAGCTGGAAGA AGG (reversed) Intergenic
No off target data available for this crispr