ID: 1126945313

View in Genome Browser
Species Human (GRCh38)
Location 15:53812829-53812851
Sequence TGTGAGCTTTAATTGGTGTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126945310_1126945313 1 Left 1126945310 15:53812805-53812827 CCCTTCTTTTAAGGATTCATCTA No data
Right 1126945313 15:53812829-53812851 TGTGAGCTTTAATTGGTGTATGG No data
1126945307_1126945313 23 Left 1126945307 15:53812783-53812805 CCTTTTATTCTGCTCTAATTTCC No data
Right 1126945313 15:53812829-53812851 TGTGAGCTTTAATTGGTGTATGG No data
1126945311_1126945313 0 Left 1126945311 15:53812806-53812828 CCTTCTTTTAAGGATTCATCTAT No data
Right 1126945313 15:53812829-53812851 TGTGAGCTTTAATTGGTGTATGG No data
1126945309_1126945313 2 Left 1126945309 15:53812804-53812826 CCCCTTCTTTTAAGGATTCATCT No data
Right 1126945313 15:53812829-53812851 TGTGAGCTTTAATTGGTGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126945313 Original CRISPR TGTGAGCTTTAATTGGTGTA TGG Intergenic
No off target data available for this crispr