ID: 1126949678

View in Genome Browser
Species Human (GRCh38)
Location 15:53867715-53867737
Sequence AATCATATTAATAGGCAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126949678_1126949683 26 Left 1126949678 15:53867715-53867737 CCTTCCTGCCTATTAATATGATT No data
Right 1126949683 15:53867764-53867786 ACTTTTGCATTATTTTGCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126949678 Original CRISPR AATCATATTAATAGGCAGGA AGG (reversed) Intergenic
No off target data available for this crispr