ID: 1126950114

View in Genome Browser
Species Human (GRCh38)
Location 15:53871447-53871469
Sequence TAAATGAGCAGAGCCTGCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126950114_1126950117 27 Left 1126950114 15:53871447-53871469 CCACAGCAGGCTCTGCTCATTTA No data
Right 1126950117 15:53871497-53871519 TCTTTGGTGCCTTCTATGCAAGG No data
1126950114_1126950115 11 Left 1126950114 15:53871447-53871469 CCACAGCAGGCTCTGCTCATTTA No data
Right 1126950115 15:53871481-53871503 ACCTTCTCTTTTCTTGTCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126950114 Original CRISPR TAAATGAGCAGAGCCTGCTG TGG (reversed) Intergenic
No off target data available for this crispr