ID: 1126955635

View in Genome Browser
Species Human (GRCh38)
Location 15:53930474-53930496
Sequence GAGTAGATTTTCTGGGAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126955630_1126955635 9 Left 1126955630 15:53930442-53930464 CCATCTTTGGAGATAATCAACCA No data
Right 1126955635 15:53930474-53930496 GAGTAGATTTTCTGGGAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126955635 Original CRISPR GAGTAGATTTTCTGGGAAGA GGG Intergenic
No off target data available for this crispr