ID: 1126957272

View in Genome Browser
Species Human (GRCh38)
Location 15:53947555-53947577
Sequence CAAGGTGATCAGAGGCATGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126957272_1126957274 -10 Left 1126957272 15:53947555-53947577 CCATCATGCCTCTGATCACCTTG No data
Right 1126957274 15:53947568-53947590 GATCACCTTGTACCTCTCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126957272 Original CRISPR CAAGGTGATCAGAGGCATGA TGG (reversed) Intergenic
No off target data available for this crispr