ID: 1126961045

View in Genome Browser
Species Human (GRCh38)
Location 15:53994876-53994898
Sequence CAGAGCTACCACCTTAGTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126961045_1126961053 5 Left 1126961045 15:53994876-53994898 CCTGAACTAAGGTGGTAGCTCTG No data
Right 1126961053 15:53994904-53994926 GGAAAAGAGGTAGGAGGTATGGG No data
1126961045_1126961050 -4 Left 1126961045 15:53994876-53994898 CCTGAACTAAGGTGGTAGCTCTG No data
Right 1126961050 15:53994895-53994917 TCTGGGAATGGAAAAGAGGTAGG No data
1126961045_1126961051 -1 Left 1126961045 15:53994876-53994898 CCTGAACTAAGGTGGTAGCTCTG No data
Right 1126961051 15:53994898-53994920 GGGAATGGAAAAGAGGTAGGAGG No data
1126961045_1126961054 30 Left 1126961045 15:53994876-53994898 CCTGAACTAAGGTGGTAGCTCTG No data
Right 1126961054 15:53994929-53994951 TGAGAGAAATTGTGAAGTTAAGG No data
1126961045_1126961049 -8 Left 1126961045 15:53994876-53994898 CCTGAACTAAGGTGGTAGCTCTG No data
Right 1126961049 15:53994891-53994913 TAGCTCTGGGAATGGAAAAGAGG No data
1126961045_1126961052 4 Left 1126961045 15:53994876-53994898 CCTGAACTAAGGTGGTAGCTCTG No data
Right 1126961052 15:53994903-53994925 TGGAAAAGAGGTAGGAGGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126961045 Original CRISPR CAGAGCTACCACCTTAGTTC AGG (reversed) Intergenic
No off target data available for this crispr