ID: 1126962959

View in Genome Browser
Species Human (GRCh38)
Location 15:54018506-54018528
Sequence TCCTACTGGAATGCTGTTTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 116}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126962959 Original CRISPR TCCTACTGGAATGCTGTTTA AGG (reversed) Intronic
904079564 1:27863450-27863472 TGCTGCTGGCCTGCTGTTTAGGG - Intergenic
907792468 1:57680751-57680773 TCCAACTAGAATGATGTCTAAGG + Intronic
909265704 1:73555784-73555806 TCCTGCTGGAATGATGTTAGAGG - Intergenic
910641812 1:89472299-89472321 TCCTACTGTAGTGCCCTTTAGGG - Intergenic
912129654 1:106586150-106586172 TCCTTCAGGAATGATGTTTTTGG - Intergenic
918387432 1:184024296-184024318 TGGTACTGGAATGCTCTGTATGG + Intronic
918518209 1:185385834-185385856 TGCTACTTGAATGCTTATTATGG + Intergenic
919261504 1:195200818-195200840 TCTTCCTGGAATGCTTTTTGAGG - Intergenic
919315978 1:195970745-195970767 CCCTCCTGGAATGTTGTTCAGGG - Intergenic
919503165 1:198363782-198363804 TCCTACAGGATTGCTCTCTAAGG + Intergenic
919534179 1:198766254-198766276 TCCAACTGGAAAGCGGTTAAAGG + Intergenic
924676628 1:246185002-246185024 TCCTAATGCAATGCTCTGTAAGG + Intronic
1063580809 10:7304938-7304960 TCCTCCTGCCATGCTGTTTCTGG - Intronic
1064565238 10:16632988-16633010 TCCTACTGGTTGGCTATTTATGG + Intronic
1065751647 10:28893018-28893040 TCATTCTGGAATGCGGTTTGTGG + Intergenic
1067209142 10:44243978-44244000 TCAGACTGGAATGCCTTTTAGGG - Intergenic
1068590016 10:58843796-58843818 TCCTAGAGGAAAGATGTTTAGGG + Intergenic
1077545149 11:3165939-3165961 TCCCAAGGGGATGCTGTTTAGGG - Intronic
1082192580 11:49265352-49265374 TCCTACTGTAATTCTATTGATGG + Intergenic
1086926630 11:92648015-92648037 TCCTACTGAAATCCTCTTTCCGG - Intronic
1087170487 11:95044986-95045008 TCCTACTGAAATGCTGATAGGGG - Intergenic
1087265323 11:96054247-96054269 TTTTAGGGGAATGCTGTTTATGG + Intronic
1088146685 11:106689182-106689204 TCCTCCTCGAATGCTATTAATGG + Intronic
1088350511 11:108881971-108881993 TCCTACTGGTTTGCTCTTGAAGG - Intronic
1093936946 12:25011562-25011584 TCCTAGTGGGATGCAGTTTAAGG + Intergenic
1094434141 12:30402517-30402539 TCCTATTGAACTGATGTTTATGG + Intergenic
1094679751 12:32657713-32657735 TTTCACTGGAAAGCTGTTTAGGG + Intergenic
1099069592 12:78028928-78028950 TGCTGCTGGCATGCTATTTAAGG - Intronic
1099475390 12:83102648-83102670 TCCTTCTGGAATGCTATCCACGG - Intronic
1101024262 12:100585197-100585219 TCCTACTTGAATGTTTTTAAAGG + Intronic
1103852948 12:123945264-123945286 TCCTGCCGGAATGCTGCTCACGG - Intronic
1105449855 13:20489749-20489771 TCATACTGTAATTCTGTTTTTGG - Intronic
1107111862 13:36706913-36706935 TGCTACTGGAATGCTTTCTTTGG - Intergenic
1109473806 13:62850243-62850265 TTCTCCTGGATTGCTCTTTAAGG - Intergenic
1110161541 13:72384345-72384367 CCTTCCTGGCATGCTGTTTAAGG + Intergenic
1113595297 13:111527464-111527486 TCCTGCTTGAATGGTGTTTGGGG + Intergenic
1119532198 14:75370238-75370260 CCTTGCTGGCATGCTGTTTATGG + Intergenic
1123984844 15:25636146-25636168 TGCTGCAGAAATGCTGTTTATGG - Intergenic
1126962959 15:54018506-54018528 TCCTACTGGAATGCTGTTTAAGG - Intronic
1130926516 15:88389635-88389657 TCCCAATGGAGTGCTGTTTATGG - Intergenic
1138803483 16:60063929-60063951 TCCAACTGGAAATCTTTTTAAGG - Intergenic
1140019107 16:71220037-71220059 TCCTACTGGAAATCTGATGATGG + Intronic
1141144232 16:81517802-81517824 TCCTTCGGGAATGCCGTTTTTGG + Intronic
1142357280 16:89607540-89607562 TGCTGCAGAAATGCTGTTTACGG - Intergenic
1143997185 17:11017005-11017027 TTCTACTGGGATGCTGTTTCTGG - Intergenic
1146133156 17:30295524-30295546 TCATACTAGAATTCTGTTTCTGG - Intergenic
1149165471 17:53746826-53746848 TCATAGTGGAATGCAGTTTCAGG - Intergenic
1153111679 18:1597934-1597956 TCCTACTGGAATGTTCTACATGG + Intergenic
1153542626 18:6172230-6172252 ACGTACTGGAATGCTGTTGAGGG + Intronic
1157169016 18:45384907-45384929 TCATGCTGGAAAGCTGTGTATGG - Intronic
1158316090 18:56212725-56212747 TCCCACTGGAAGCATGTTTAAGG + Intergenic
1161647641 19:5463810-5463832 TCCTGCTGGAAGTCTGTATATGG - Intergenic
943112971 2:183629200-183629222 TTCTTGTGGAATGCTGTTTTGGG - Intergenic
943196668 2:184761084-184761106 TCTTACTGGAATACTTTTCACGG + Intronic
948975930 2:241464002-241464024 GCCTACATGAATGCTGTTTATGG + Intronic
1174716171 20:52761276-52761298 ACCTACTGAAATGCTCTTTGGGG + Intergenic
1175251208 20:57611104-57611126 TGAGACTGGAATGGTGTTTAGGG - Intronic
1177781555 21:25627331-25627353 TCTTTCTGGAATGCTCTTTTAGG - Intergenic
1178294288 21:31395843-31395865 CCCTACTGGCCTGCTGTTTCAGG - Intronic
1181481770 22:23204538-23204560 TCCTACAGGAAGGCTGCTTTGGG - Intronic
1182878550 22:33713350-33713372 TCCTAGCGAAAGGCTGTTTAGGG - Intronic
1183745975 22:39691867-39691889 TCCTCCTGGGATGCTGCTTTTGG + Intergenic
949833142 3:8238349-8238371 TCCTAGTGAAGTGTTGTTTATGG - Intergenic
951948393 3:28168877-28168899 TCTAACTGCAATGCTGGTTATGG + Intergenic
953933037 3:47015986-47016008 GCCCACTGGAATGCTTTTTTTGG - Intergenic
954276459 3:49544945-49544967 CCCTTCTGGAACTCTGTTTAAGG - Intergenic
956110183 3:65862477-65862499 TCCTGCTGTGCTGCTGTTTATGG - Intronic
961835175 3:129651986-129652008 TCCCACTGGAATGCAGTGGAGGG - Intronic
965208380 3:165751417-165751439 TCCCACTTGAATGCTGTTTTTGG + Intergenic
965370453 3:167855753-167855775 CCCTACTGAAATGCTATTAATGG - Intergenic
976106883 4:81628548-81628570 TCCTTATGGAATGGTGTTGATGG - Intronic
976838072 4:89398608-89398630 TGCTTCTGGACTGCTCTTTAAGG + Intergenic
977983700 4:103357403-103357425 TCTTTCTGGAAGGCTGATTATGG - Intergenic
978397933 4:108302292-108302314 TACTACTGGAATTCTGTGTAAGG + Intergenic
979406747 4:120321549-120321571 TCCTACTGGAAGGCATTTAAGGG + Intergenic
981943042 4:150306585-150306607 TCCCACTGAAATGAAGTTTAAGG + Intronic
983011400 4:162552027-162552049 TCCTATTTGAATTCTATTTATGG - Intergenic
983300179 4:165915246-165915268 TCAAACTGGAATTCTTTTTAAGG + Intronic
983319215 4:166174603-166174625 TCTGCCTGGAATGCTGTTAAGGG - Intergenic
983409547 4:167379417-167379439 TGTTACTGGAATGCTGATTATGG + Intergenic
986285015 5:6352952-6352974 TCCTGTTGGAATGCGGGTTAAGG + Intergenic
986441383 5:7785441-7785463 TCCTGCTGCAAAGCTGTTTGAGG + Intronic
988414659 5:30930992-30931014 GGCTAATGGAATGCAGTTTAAGG + Intergenic
988538646 5:32090041-32090063 GCCCCCTGGAATGCTGTTTCTGG - Exonic
992164099 5:74031550-74031572 CCTGACTGGACTGCTGTTTATGG - Intergenic
992351400 5:75932789-75932811 TGCTACAGAAATCCTGTTTATGG + Intergenic
992858757 5:80891047-80891069 CCCAACTGCAATGCTCTTTAGGG + Intergenic
993005911 5:82428100-82428122 TCCTACTGGAAAGCTGTTCTTGG + Intergenic
993489370 5:88527632-88527654 TCCTACTGGCAAGCTGTCTGAGG - Intergenic
998515723 5:142752203-142752225 GCCTCCTGGAATGCTGTTCTGGG + Intergenic
999077569 5:148811433-148811455 TCCTACTGGAAGGCCTTTAAGGG + Intergenic
1003483869 6:6557487-6557509 TCCTACTGAAATGTTGTATTTGG - Intergenic
1003631264 6:7789877-7789899 ACCTTCTGGATTGCTGATTATGG + Intronic
1007013301 6:38438271-38438293 TACTACTGGATTGCAGCTTATGG + Intronic
1008097756 6:47357351-47357373 ACCTAGTGGTATGCTGATTAAGG + Intergenic
1008251496 6:49245378-49245400 TCCCACTGGAGTGCTGTTGGAGG + Intergenic
1008669533 6:53753368-53753390 TCCTCCAGGAAAGCTGTTAATGG + Intergenic
1009188963 6:60606517-60606539 TCCCACAGGAATCCTGTTTGAGG - Intergenic
1014577019 6:123086173-123086195 TCATAGTGCAGTGCTGTTTATGG + Intergenic
1016751291 6:147633188-147633210 TGCTTCTGGAATGCTGTATTTGG - Intronic
1018215409 6:161521775-161521797 TCTCACGGGAAAGCTGTTTATGG - Intronic
1020906945 7:14075162-14075184 ACCTACTGTAAGGCTGCTTAAGG + Intergenic
1021950056 7:25765873-25765895 TGCTACAGTAATGCTGTTTCAGG - Intergenic
1024168662 7:46761653-46761675 TCCCATTTGAATGCTGTTTTGGG - Intergenic
1028930411 7:96407024-96407046 TCCTAATAAAATGGTGTTTATGG - Intergenic
1036614147 8:10375454-10375476 CCCTAGTGGAATGATGTTTGTGG + Intronic
1039377707 8:37053044-37053066 TCTTACTGAAATACTGATTAAGG - Intergenic
1042112488 8:65395524-65395546 GCCTGCTGGAATAGTGTTTATGG - Intergenic
1042523670 8:69742482-69742504 TCCTACTTTACTACTGTTTAAGG - Intronic
1043108620 8:76149283-76149305 GCCTACTGGAATGCAGATTTTGG - Intergenic
1044784370 8:95778838-95778860 TCCTACTGGAATACATTATATGG - Intergenic
1045893534 8:107186394-107186416 TCCTTCTGAAGTGCTGTATATGG + Intergenic
1046034625 8:108825807-108825829 TCCTTCTAGAGTGCTGTTAAGGG + Intergenic
1046212321 8:111093045-111093067 TTCCAATGTAATGCTGTTTAAGG + Intergenic
1051105554 9:13575623-13575645 TCTTACTGAAATGCTCTTAAAGG - Intergenic
1052324497 9:27203020-27203042 TCCACCTGGTATGCTGTTTCAGG - Exonic
1056726054 9:89118769-89118791 TCCTACTGGGATGCTAGTTTGGG - Intronic
1059661282 9:116404243-116404265 TTCTAAAGGAATGATGTTTAAGG + Intergenic
1060678820 9:125543154-125543176 TCCTACAGAAATGCTGCTCATGG - Exonic
1060909707 9:127339813-127339835 TTCTCCCAGAATGCTGTTTAAGG + Intronic
1185622064 X:1456081-1456103 TCCTTCTGGAATGCTGGTATGGG - Intergenic
1189789066 X:44586129-44586151 TCCTACTGACATCCTGTTCAAGG - Intergenic
1191104401 X:56763703-56763725 TCCTGTGGGAATCCTGTTTAGGG - Intergenic
1192966790 X:76185297-76185319 TTCTACTGAAAGTCTGTTTAAGG - Intergenic
1196155157 X:112420297-112420319 TCCAACTGGAAGGCTGTTTTGGG - Intergenic
1198313530 X:135444121-135444143 TCCAACTGGTATGCTGTGAATGG - Intergenic
1200302968 X:154996972-154996994 TCCTACTGGAAAGCTTCTGAGGG - Exonic