ID: 1126962968

View in Genome Browser
Species Human (GRCh38)
Location 15:54018585-54018607
Sequence GTTGCTGGCCCCTGCTGAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 153}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126962964_1126962968 0 Left 1126962964 15:54018562-54018584 CCCATGAGTCAAATTCTTCCATT 0: 1
1: 0
2: 3
3: 18
4: 304
Right 1126962968 15:54018585-54018607 GTTGCTGGCCCCTGCTGAGTTGG 0: 1
1: 0
2: 0
3: 14
4: 153
1126962962_1126962968 11 Left 1126962962 15:54018551-54018573 CCAGAAGCTTCCCCATGAGTCAA 0: 1
1: 0
2: 2
3: 30
4: 221
Right 1126962968 15:54018585-54018607 GTTGCTGGCCCCTGCTGAGTTGG 0: 1
1: 0
2: 0
3: 14
4: 153
1126962963_1126962968 1 Left 1126962963 15:54018561-54018583 CCCCATGAGTCAAATTCTTCCAT 0: 1
1: 0
2: 2
3: 16
4: 316
Right 1126962968 15:54018585-54018607 GTTGCTGGCCCCTGCTGAGTTGG 0: 1
1: 0
2: 0
3: 14
4: 153
1126962961_1126962968 28 Left 1126962961 15:54018534-54018556 CCTTAGAGTGTGTGTAGCCAGAA 0: 1
1: 0
2: 1
3: 11
4: 138
Right 1126962968 15:54018585-54018607 GTTGCTGGCCCCTGCTGAGTTGG 0: 1
1: 0
2: 0
3: 14
4: 153
1126962965_1126962968 -1 Left 1126962965 15:54018563-54018585 CCATGAGTCAAATTCTTCCATTG 0: 1
1: 0
2: 1
3: 21
4: 266
Right 1126962968 15:54018585-54018607 GTTGCTGGCCCCTGCTGAGTTGG 0: 1
1: 0
2: 0
3: 14
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126962968 Original CRISPR GTTGCTGGCCCCTGCTGAGT TGG Intronic
900679869 1:3910865-3910887 GGTGCAGACCCCTGTTGAGTAGG + Intergenic
901242222 1:7702161-7702183 CTGGCTGAGCCCTGCTGAGTGGG - Intronic
901785660 1:11622857-11622879 GCTGCTGGTCCCAGCTGACTGGG + Intergenic
902092171 1:13912308-13912330 TTATCTGGCCTCTGCTGAGTTGG + Intergenic
902777220 1:18682658-18682680 GTTGCTGGCCCCAGAGGAGGGGG - Intronic
904777618 1:32920907-32920929 CTTGCTGGACGCTGCTGAGAGGG - Intergenic
905445427 1:38025673-38025695 GTCTCTTGCCCCTGCTGGGTGGG + Intergenic
911738304 1:101361260-101361282 GTGGCTGGACCCCTCTGAGTGGG - Intergenic
913336069 1:117709954-117709976 GTTCCTGTCCCCTGCTGCATGGG + Intergenic
919755853 1:201066031-201066053 CTTGCTGCCTCCTGATGAGTTGG + Intronic
922227253 1:223656108-223656130 GGTGCTGGCTCCTGCTGAAATGG + Intronic
922859426 1:228803482-228803504 GTCGCTGTGCCCTGCTAAGTAGG - Intergenic
924435554 1:244037483-244037505 CTTGCTGGGCCCTGCTGTTTGGG - Intergenic
1063917423 10:10897624-10897646 ATTGCTGGCCTCTGCTGAGATGG - Intergenic
1064318256 10:14277806-14277828 CTCTCTGGGCCCTGCTGAGTGGG - Intronic
1070386879 10:75933799-75933821 GTAGCTGTCTCCTGCTGAATGGG + Intronic
1072211257 10:93248940-93248962 GCTGCGGGACCCTGCTGGGTGGG + Intergenic
1072409042 10:95183755-95183777 GCTGCTGCCCCCTGCTGGGGCGG - Intergenic
1075668450 10:124246999-124247021 GCTGCTGGCCCCTGCAGTGGAGG - Intergenic
1076535524 10:131174377-131174399 CTTCCTGGGCCCTGCTCAGTAGG + Intronic
1083419024 11:62543148-62543170 GGTGCAGGCCCCAGCTGAGCAGG - Intronic
1084033531 11:66494525-66494547 ATTCCTGACCCCTGCTGTGTGGG + Intronic
1084172028 11:67405445-67405467 GATGCTGGCCCCTGTTGTGTGGG + Exonic
1088750025 11:112835607-112835629 CTAGCTGGCACCTGCAGAGTGGG - Intergenic
1089739934 11:120575522-120575544 GGTGCTGGCCGCCGCTGAATGGG + Intronic
1091749282 12:3012469-3012491 CTTGCTGGCTCCTGCTTAGAGGG + Intronic
1093493197 12:19726925-19726947 GAGCCTGGCCCCTTCTGAGTTGG - Intergenic
1093789898 12:23236889-23236911 GTTGCTGGCCACTTCTGTCTGGG - Intergenic
1099056690 12:77850818-77850840 CTTGCTGGTCTCTGCAGAGTTGG + Intronic
1100152730 12:91760574-91760596 GTTTCTGGCTTCTGCTGAGATGG - Intergenic
1102467059 12:113135950-113135972 GCCGCTGGCTCCTGGTGAGTTGG + Intronic
1102909950 12:116705687-116705709 GTTGCACGCCACTGCGGAGTTGG - Intergenic
1103960301 12:124605339-124605361 GTTGCAGGCCCCTGCAGGGAGGG - Intergenic
1104929040 12:132328790-132328812 GTTGCTGCCCGCTGCTGAAGGGG + Intronic
1106891842 13:34254383-34254405 GTTGGTGTCCCCTGCAGAGGGGG - Intergenic
1107457607 13:40569284-40569306 ACTGCTGGGCCCTTCTGAGTAGG + Intronic
1107803344 13:44131213-44131235 GTTACTTGGCCATGCTGAGTTGG + Intergenic
1113182149 13:107641774-107641796 CTCGCTTGCTCCTGCTGAGTTGG - Intronic
1113948495 13:114058244-114058266 GGAGCTGGCCCCTGCCGGGTGGG - Intronic
1113988498 13:114339096-114339118 GTCACTGGCCCCTGCAGTGTTGG + Intergenic
1118135986 14:63028267-63028289 ATAGCTGGACCCTGCTGAGCTGG - Intronic
1121635776 14:95453038-95453060 CTTGCTTGGCCCTGCTCAGTAGG + Intronic
1126962968 15:54018585-54018607 GTTGCTGGCCCCTGCTGAGTTGG + Intronic
1128350248 15:66883649-66883671 ATTGCTGGCCCCTGCCAAGCCGG - Intergenic
1129057341 15:72830085-72830107 ATTCCTGGCTCCTGCTGAGATGG + Intergenic
1130019462 15:80215751-80215773 GGGGCGGGCCACTGCTGAGTTGG - Intergenic
1130725723 15:86437556-86437578 GTGGCGGGACCCAGCTGAGTTGG - Intronic
1131406212 15:92166953-92166975 ATAGCTTGCCACTGCTGAGTAGG - Intronic
1131979574 15:97981659-97981681 CTGAGTGGCCCCTGCTGAGTGGG + Intergenic
1133394926 16:5439172-5439194 GCAGCTGGGCCCTGGTGAGTCGG + Intergenic
1135249196 16:20886247-20886269 GGTGATGGCCACTGCTGAGCAGG - Intronic
1135895874 16:26401960-26401982 GTTGCTGGCACCTGGGGGGTTGG + Intergenic
1136380524 16:29892522-29892544 CTTGCTGGCCCCCGATGAATAGG + Intronic
1137909321 16:52360507-52360529 ATTCCTGGCCCCTGTTGAGGTGG - Intergenic
1142049499 16:87949077-87949099 GTTGAAGGCCACTGCTGACTAGG - Intergenic
1144318424 17:14087813-14087835 GGTGCTGTGGCCTGCTGAGTTGG + Intronic
1144782933 17:17816931-17816953 GGGGCTGGCCCCGGCAGAGTGGG - Intronic
1144961516 17:19046821-19046843 GGGGCTGGAGCCTGCTGAGTTGG - Intronic
1144973644 17:19127703-19127725 GGGGCTGGAGCCTGCTGAGTTGG + Intronic
1146054513 17:29574430-29574452 CTTGCAGGCCCCTGCTCACTAGG + Exonic
1147374727 17:40016750-40016772 GTGGTTGGGCCCTTCTGAGTGGG - Intronic
1147382891 17:40065958-40065980 CTGGCAGGACCCTGCTGAGTTGG + Intronic
1147795763 17:43041655-43041677 GTTGCTGGCCCCACCTGTCTGGG + Intergenic
1147914979 17:43880661-43880683 GGAGCTGGGCCCTGCTGAGTTGG - Intronic
1149652243 17:58282665-58282687 GATTCTGTCCCCTGCTGAGAAGG + Intergenic
1150322201 17:64224630-64224652 GGTGCAGGACCCTGCTGGGTCGG - Intronic
1151844204 17:76639989-76640011 GTTGGGGGCCCCTGCTGACTTGG + Intronic
1152239637 17:79154723-79154745 GCTGCTGGCCCCTGCCCCGTTGG + Intronic
1152891680 17:82885183-82885205 GTGTGTGGCCCCTGGTGAGTGGG + Intronic
1152891701 17:82885257-82885279 GTGTGTGGCCCCTGGTGAGTGGG + Intronic
1153477092 18:5508997-5509019 GAAGCTGGCCTCTGCTGCGTTGG - Intronic
1156199054 18:34809224-34809246 GTGGCTGCCCCTTGGTGAGTGGG + Intronic
1156409132 18:36811040-36811062 GGTGCTGGTCCATGCTGAGCTGG + Intronic
1160418631 18:78728931-78728953 GCTGGTGTCCGCTGCTGAGTCGG + Intergenic
1160591183 18:79945481-79945503 GGTGGTGGCCCCTGCTGACCTGG - Intronic
1161363934 19:3867984-3868006 GTTGCTGCCCCCTGCCCAGTCGG + Intronic
1163458750 19:17424054-17424076 GCTGCAGCCCCCTGGTGAGTCGG + Exonic
1163646161 19:18490348-18490370 GAAGCTGGTCCCTGCTGTGTCGG - Intronic
1163761669 19:19140324-19140346 GTGGCTCACCCCTCCTGAGTGGG + Intergenic
1164781818 19:30898795-30898817 GTTGTTGGCTCCTGCAGATTGGG + Intergenic
1166060596 19:40323191-40323213 GTTGCTGCACCCTGCAGAGCAGG + Intronic
924959358 2:19976-19998 GTTACTGGCCCCTGCAGCATGGG - Intergenic
931239511 2:60439667-60439689 TTTTCCGGCCCCTGCTGAGAGGG + Intergenic
932507972 2:72255123-72255145 GTTTCTGGCTTCTGCTGAGATGG - Intronic
933941098 2:87245836-87245858 GTTGGTGACCCCAGCTGAGGAGG + Intergenic
935585993 2:104800868-104800890 GTTGCTGAACACTGCTGAGATGG - Intergenic
936352043 2:111720176-111720198 GTTGGTGACCCCAGCTGAGGAGG - Intergenic
936477601 2:112853106-112853128 CTTGCTGCCCCCTTCTGGGTTGG + Intergenic
937123137 2:119454485-119454507 GTGGCTGGTCCCTACTGAGTTGG + Intronic
941153504 2:161945014-161945036 GTTCTTTGCCCTTGCTGAGTTGG - Intronic
941991067 2:171557742-171557764 GATTCTTTCCCCTGCTGAGTTGG + Exonic
948028884 2:234800457-234800479 GTTGCTGGTCCCTGCAGAAGGGG - Intergenic
948648828 2:239426239-239426261 GTTGCTGGCCCCAGAGGAGGTGG - Intergenic
948696545 2:239735843-239735865 GCTGCTGGCCTCGGCAGAGTCGG - Intergenic
1169397052 20:5241646-5241668 CTTGCTGGCCTCTGCGGAGGTGG + Intergenic
1171486690 20:25490857-25490879 GGTGCTGGCCCTTGCTGTGCTGG - Intronic
1172130283 20:32650620-32650642 GCTGCGGGCCCCTGCTGGGCGGG - Intergenic
1172216972 20:33242540-33242562 GGGGCTGGCCTCTGCTGAGCTGG + Exonic
1172237376 20:33387417-33387439 GCTGCTGGCTGTTGCTGAGTCGG - Exonic
1172612010 20:36259573-36259595 GATGCTGTCCCCTGCTGACATGG + Intronic
1173193910 20:40897869-40897891 GTGGCTGGTGCCTGCTGAGTTGG - Intergenic
1173470173 20:43317500-43317522 GTGGCTGGTGGCTGCTGAGTTGG - Intergenic
1177026930 21:15932071-15932093 TTTGCTGACACCTGCAGAGTGGG + Intergenic
1178391909 21:32205812-32205834 GTTGCTGGCCCCTTCAGGATGGG + Intergenic
1178666984 21:34556844-34556866 GTTGCAGGGCCATGCTGAGAAGG + Intronic
1181537411 22:23553731-23553753 GTGTCTGGCTCCTGGTGAGTGGG + Intergenic
1181589781 22:23876941-23876963 GTGGCTGGACAGTGCTGAGTGGG + Intronic
1182661265 22:31926898-31926920 GAAGCTGTGCCCTGCTGAGTTGG + Intergenic
1184037656 22:41926318-41926340 GCTGCTGGCCCCGGCTGCTTCGG + Exonic
1184188799 22:42881427-42881449 GGCTCTGGCCGCTGCTGAGTCGG + Intronic
950544465 3:13630331-13630353 GCTGTTGGCCCCAGCTCAGTGGG + Intronic
950932779 3:16807614-16807636 TGTTCTGGCCTCTGCTGAGTGGG + Intronic
951853599 3:27170201-27170223 GATGCTGCCACCTCCTGAGTGGG + Intronic
953663434 3:44907602-44907624 CTTTCTGGCCCCTGCAGAGCTGG + Intronic
954637198 3:52077439-52077461 GTGGCTGGCCCCTTCTAAATGGG + Intronic
959495877 3:107051078-107051100 GTTGCTGTCCCATACTGAATCGG + Intergenic
961684551 3:128620640-128620662 GATGGTGGGGCCTGCTGAGTGGG - Intronic
963127394 3:141827995-141828017 CTTGCAGGCCCCTGCTCACTAGG + Intergenic
967142363 3:186571394-186571416 GTTGCTGTGCCCCGCTGAGGTGG + Intronic
967583296 3:191185651-191185673 GTTGGTTGCCCCTGCTGGTTAGG - Intergenic
967987805 3:195107916-195107938 GCTGCTGGCCAGTGCTGAGGAGG + Intronic
968075787 3:195815554-195815576 GCTGCTGGCCCCTGCAGGGTGGG + Intergenic
969515923 4:7648262-7648284 TCTGCTGGGCCCTGCTAAGTTGG + Intronic
970077619 4:12242549-12242571 GTTCCTGCCCCTTTCTGAGTAGG + Intergenic
972913293 4:43846277-43846299 GCTGCTGGCCCCTGCAGTGAGGG + Intergenic
973643506 4:52926739-52926761 GGAGGTGGCCCCTGCTGCGTTGG - Intronic
976344521 4:83985150-83985172 GTTCCTGGCCCCTTCTGGCTGGG + Intergenic
976660669 4:87536979-87537001 ATTTCTGGCTCCTGCTGAGAAGG + Intergenic
979191298 4:117862490-117862512 CTTTCTGTTCCCTGCTGAGTAGG - Intergenic
981332880 4:143532911-143532933 GTTGCTGCCGCCTGTTGACTAGG + Intronic
983563412 4:169124684-169124706 GTTGCTTGCCCCTGTGGGGTTGG + Intronic
984568576 4:181362031-181362053 GTTCCTGACTCCTGCTTAGTTGG - Intergenic
985019325 4:185670821-185670843 TTTGCTGGCCACAGCTGATTAGG + Intronic
985779189 5:1861058-1861080 GCTGCTGGCCTCTGCAGGGTGGG - Intergenic
986173563 5:5333028-5333050 GTTGGAGGCCCCTGCAGGGTTGG - Intergenic
986905339 5:12488573-12488595 GTGGCTGGCACATGCTGAGCGGG - Intergenic
988128280 5:27072306-27072328 TTTGCTTGCCCCTTCTGATTTGG - Intronic
997977044 5:138446677-138446699 GGTACAGGCCCCTGCTGAGTGGG + Exonic
1002438161 5:179246137-179246159 CTTCATGGCCACTGCTGAGTTGG - Intronic
1002782030 6:374267-374289 GATGCTGGCCCCTGGCGAGCAGG - Intergenic
1006314245 6:33280665-33280687 CATGCTGGTCCCTGGTGAGTGGG - Exonic
1006521870 6:34575521-34575543 GCTTCCGGTCCCTGCTGAGTAGG + Intergenic
1007923759 6:45634481-45634503 GTCGCTGGACCCTGCCCAGTGGG + Intronic
1013516576 6:110892466-110892488 GTTGCTGGACTCTTCTGCGTGGG + Intronic
1015127726 6:129772935-129772957 GTTCCTGGCCCCTTCTGTCTTGG + Intergenic
1020829336 7:13074563-13074585 GATGCTGACCCCTGCAGAGAAGG - Intergenic
1022040918 7:26580431-26580453 GTTGCTGGTCACAGCTGAGTGGG - Intergenic
1022378304 7:29835819-29835841 GTTCCTGGCTTCTGCTGACTTGG - Intronic
1032540687 7:132700450-132700472 GTCCCTGGCCCCTGCTGTGTTGG - Intronic
1034636159 7:152568886-152568908 TTTTCTGGCCCCTGCTGGGCAGG + Intergenic
1036005445 8:4656861-4656883 GTTGGGGGCCCCTGCTGATTTGG - Intronic
1037755497 8:21707430-21707452 GGTGCTGGTGCCTGCTGAGGGGG + Intronic
1038537137 8:28361215-28361237 CTTCCTGGCTCCTGCTGTGTGGG - Intronic
1039466017 8:37786069-37786091 TCTGCTGGCCCCAGCTGTGTTGG + Intronic
1039944195 8:42116075-42116097 GCTGCTGGCCCTTACTGAGCTGG + Intergenic
1041189991 8:55343622-55343644 GTTAATGGCCCCTGCAGACTGGG + Intronic
1044370082 8:91399914-91399936 ATTTCTGGCTCCTGCTGAGGTGG + Intergenic
1047636837 8:126772955-126772977 GTTGCTGGTCACTGGTGAGGTGG + Intergenic
1048990798 8:139759054-139759076 GTTGATGGCAACTGGTGAGTGGG + Intronic
1055572507 9:77631903-77631925 GATCCTCGCCCCTTCTGAGTTGG + Intronic
1061352763 9:130078831-130078853 GTCACTGGCCCCTCCTGGGTGGG + Intronic
1062386106 9:136312109-136312131 GCTGCTGGGCCCTGCTGGCTGGG - Intergenic
1192437730 X:71153264-71153286 GTTGCAGGCCCCTGCTGTGCTGG - Intronic
1194355185 X:92874453-92874475 CTTTCTGGCTCCTGCTAAGTTGG + Intergenic
1197651691 X:129072241-129072263 GTTGTCTGCCCCTGCTGAGTGGG - Intergenic
1198720329 X:139611214-139611236 GTCACTGGCTCCTGCTGAGGAGG - Intronic
1200663542 Y:5991475-5991497 CTTTCTGGCTCCTGCTAAGTTGG + Intergenic
1201907479 Y:19100528-19100550 GTGGGTTGCCGCTGCTGAGTGGG + Intergenic