ID: 1126969249

View in Genome Browser
Species Human (GRCh38)
Location 15:54091103-54091125
Sequence CAGGGGAACCCCACTGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 243
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 223}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126969249_1126969256 9 Left 1126969249 15:54091103-54091125 CCTTCCTCAGTGGGGTTCCCCTG 0: 1
1: 0
2: 0
3: 19
4: 223
Right 1126969256 15:54091135-54091157 TGACACTGAACTGCTTTTTGAGG 0: 1
1: 0
2: 0
3: 10
4: 241

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126969249 Original CRISPR CAGGGGAACCCCACTGAGGA AGG (reversed) Intronic
900074007 1:797492-797514 CAAGGCCACACCACTGAGGAGGG + Intergenic
902391626 1:16110491-16110513 CAGGAAAACCGCTCTGAGGAGGG + Intergenic
903070723 1:20725880-20725902 CAGGGGACCGCCACGGAGGCCGG - Intronic
903076576 1:20773110-20773132 CAGGGGCGCCCAACAGAGGAAGG + Intronic
904585203 1:31576303-31576325 TAGGGGAACCCCAAGCAGGAAGG - Intergenic
904775947 1:32906629-32906651 CATGTGAAGGCCACTGAGGATGG - Intergenic
905304529 1:37008248-37008270 CAGGGGAACCCCGCTCGGTAAGG - Intronic
905329364 1:37181573-37181595 CAGGGGAGCCCCAAAGAGGGAGG - Intergenic
905396750 1:37671272-37671294 CAGGCGCACCCCACTGAGCCTGG - Intergenic
906546449 1:46622651-46622673 CAAGGGCTCCCCCCTGAGGAGGG - Intergenic
911740898 1:101385887-101385909 CAGGGGATCCACCCTTAGGATGG - Intergenic
913044568 1:115062794-115062816 CAGGGGTTCCCCACAGAGGCGGG - Intronic
915737416 1:158093854-158093876 CAGGGAAGACCGACTGAGGAAGG - Intronic
916117793 1:161502470-161502492 AACTAGAACCCCACTGAGGAAGG + Intergenic
919711969 1:200738129-200738151 CAGAGGAACCACCCTGAGCAAGG + Intergenic
919939504 1:202276541-202276563 CAGCAGGACCCCACTGGGGATGG - Intronic
921065956 1:211621992-211622014 CCCGGGGACCCCACTGGGGAGGG - Intergenic
921119898 1:212127244-212127266 CAGGGGTGACCCCCTGAGGAAGG - Intergenic
922269860 1:224022397-224022419 CAAGGCCACACCACTGAGGAGGG + Intergenic
923790577 1:237107859-237107881 CAGGGGAACCCCAGGGAAGGAGG - Intronic
1067057572 10:43061262-43061284 CAAGTGGACCCCAGTGAGGACGG - Intergenic
1067948607 10:50708736-50708758 CAGGGGAACCCCAGAGAGATGGG - Intergenic
1068530296 10:58178559-58178581 CAGGGGAACACAACTGAGACTGG + Intergenic
1068588048 10:58822530-58822552 CTGGTGAACCCCACTGAGAGAGG - Intronic
1069588012 10:69621513-69621535 CAGAGGAACAGAACTGAGGAAGG - Intergenic
1069655317 10:70083439-70083461 CAGGGGAAGCCTACTGATGGTGG - Intronic
1070883930 10:79873733-79873755 CAGGGGAACCCCAGAGAGATGGG - Intergenic
1071650484 10:87390033-87390055 CAGGGGAACCCCAGAGAGATGGG - Intergenic
1073538006 10:104295399-104295421 TAGGGCAACCCCTCTGAGAAGGG + Intronic
1074869410 10:117565036-117565058 CAGGGGCACTCCCCTGGGGAGGG + Intergenic
1075638068 10:124043902-124043924 CAGGGGAACAGCACAGAGCAGGG + Intronic
1075638071 10:124043920-124043942 CAGGGGAACAGCACAGAGCAGGG + Intronic
1075638074 10:124043938-124043960 CAGGGGAACAGCACAGAGCAGGG + Intronic
1075638088 10:124044060-124044082 CAGGGGAACAACACAGAGCAGGG + Intronic
1076167125 10:128291828-128291850 CAAGGGAAAGCCACTGAAGAAGG - Intergenic
1076275255 10:129193000-129193022 CAGGGCAGCCCCAATGTGGACGG + Intergenic
1076496096 10:130898733-130898755 CACGGGATCCCCATGGAGGATGG + Intergenic
1076522554 10:131090118-131090140 CATGGGAACACCACTGAGTCGGG + Intergenic
1076616403 10:131757973-131757995 CCTGGGAGCTCCACTGAGGAGGG + Intergenic
1077438266 11:2555368-2555390 CCTGGGAACCCCACTGCTGATGG - Intronic
1077478176 11:2800760-2800782 CAGGAGATCCCCATTGAGCACGG + Intronic
1077499599 11:2903163-2903185 CAGGAGAGCTCCACTGGGGAGGG + Intronic
1077550467 11:3197894-3197916 CAGGAGAGACCCACTGAGGCAGG + Intergenic
1078035156 11:7796205-7796227 CAGGGTAACCACAGTGAGGTGGG + Exonic
1079385693 11:19977317-19977339 CAGGGAACCCCAACTGAGAAAGG + Intronic
1083045318 11:59729249-59729271 CAGGAGAACCACAATGAGGTGGG - Intronic
1084491632 11:69481737-69481759 CAGGAGATCCCTACAGAGGAAGG + Intergenic
1085218948 11:74856725-74856747 CAGGCTCACACCACTGAGGAAGG - Intronic
1085375926 11:76060845-76060867 CACAGGATCCCCACGGAGGAGGG - Intronic
1086444289 11:86857919-86857941 CAGGGAGAGCCCAGTGAGGACGG + Intronic
1087841569 11:102925897-102925919 CAAGTGAACCCCACTGACCATGG - Intergenic
1091021602 11:132104995-132105017 CATGGGAAGCCAAATGAGGAGGG + Intronic
1093018112 12:14175296-14175318 CAGGGGAATCTCACTGACTAAGG - Intergenic
1096547187 12:52348179-52348201 CAGGGCAGCCCCACTGAGACAGG + Intergenic
1096797867 12:54089884-54089906 CAGGGGAACCCCAGAACGGATGG + Intergenic
1100764250 12:97846046-97846068 CTGGGGACCCCCTCTGAGTATGG + Intergenic
1101348107 12:103904929-103904951 CTGGGGAATCTCATTGAGGAAGG - Intergenic
1102112596 12:110376025-110376047 TGGGGGAAGGCCACTGAGGAGGG - Intronic
1102218566 12:111179129-111179151 GAGGGGATCCTCAATGAGGAGGG - Intronic
1104183726 12:126408181-126408203 TAGGGGAATCCCACTGTGGTGGG + Intergenic
1106287255 13:28328713-28328735 CATGGAAGCCCCTCTGAGGACGG - Intronic
1106384069 13:29267328-29267350 GAGGGGAAACCCACTTTGGAAGG - Intronic
1106888709 13:34218949-34218971 CAGGGTCATCCCACTGTGGAAGG + Intergenic
1107860898 13:44660174-44660196 CTCAGGAACCCCAATGAGGAAGG - Intergenic
1112464552 13:99632144-99632166 GAGGGAAACCCCAGAGAGGAGGG + Intronic
1118301308 14:64618910-64618932 CTGGGGCACCCAACTGAGGAAGG - Intergenic
1118842131 14:69521407-69521429 AATGGAAACCCCACTGGGGAGGG - Intronic
1119473116 14:74911460-74911482 CAGGGGCACCCGAATGAGGGTGG + Intronic
1119955764 14:78797134-78797156 CAGGGGAACCTTTCTGAGGGGGG + Intronic
1121313960 14:92950200-92950222 CAGGGGCATCCCACTGGGAAGGG + Intronic
1121505562 14:94474219-94474241 CAGGGGGCCCCCACTGACGCTGG + Intronic
1121661845 14:95640846-95640868 CAGGGTCACCTCACTGAGCAGGG + Intergenic
1124233726 15:27968781-27968803 CAGGGAAACCACACAGAGGCGGG + Intronic
1126789594 15:52209046-52209068 CAGGGAAACCTCAGAGAGGAAGG + Intronic
1126969249 15:54091103-54091125 CAGGGGAACCCCACTGAGGAAGG - Intronic
1128592127 15:68908615-68908637 CAGGGAAAGCCCAGTGAGGCTGG + Intronic
1129103226 15:73285863-73285885 CAGGGGAAGTACACTTAGGAGGG - Intronic
1132806758 16:1778544-1778566 CACGGGCACCGCACTGGGGATGG + Exonic
1134015668 16:10886435-10886457 CAGGAGAACCCATCTGAGGATGG - Intronic
1137398796 16:48136271-48136293 CTGGGGAAGCCCACTTAGGGAGG - Intronic
1137668055 16:50263172-50263194 CCTGGCAGCCCCACTGAGGAAGG - Intronic
1137710518 16:50563642-50563664 CAGGGCTTGCCCACTGAGGATGG - Intronic
1138308658 16:56004085-56004107 CAGGTGAACCACCCTGAGGACGG - Intergenic
1138451810 16:57097788-57097810 CAGGGGACTCCCATGGAGGAGGG - Intronic
1138502629 16:57457253-57457275 TAGGAGAACCCCACCCAGGATGG - Intronic
1139255852 16:65541825-65541847 CAGGGGAATCCCAGGAAGGAAGG - Intergenic
1139471042 16:67178402-67178424 CCGGCGAACCCCACGGAGGAGGG - Exonic
1141542306 16:84735122-84735144 CATGAGAACCCCCCTGAGGCGGG - Intronic
1141666802 16:85469942-85469964 GCGGGGAACCACAGTGAGGATGG - Intergenic
1142273335 16:89102493-89102515 CTGGGCCTCCCCACTGAGGAAGG - Intronic
1142341058 16:89522865-89522887 CAGGGAGACGCCTCTGAGGAGGG - Intronic
1143733892 17:8897052-8897074 CATGGGACCCCCAGTGAGGAGGG - Intronic
1147888297 17:43699142-43699164 CAGGGGAAGCCCCCTGATAAGGG - Intergenic
1147920505 17:43913756-43913778 TAGGTGAACCCCAATGAGGAGGG - Intergenic
1148144343 17:45353216-45353238 AAGGGGAAACACACTGAGGAGGG - Intergenic
1148236367 17:45971867-45971889 CTGCAGACCCCCACTGAGGACGG + Exonic
1148834942 17:50461093-50461115 CAGGGCAGACCCACTGAGGCTGG + Intronic
1150391968 17:64795197-64795219 CAGGGGAACCCCGCAGAAGTTGG - Intergenic
1151350165 17:73527145-73527167 CAGGGGAGCTCCAGGGAGGAAGG + Intronic
1152003764 17:77664143-77664165 TAGGGGAGCCCCACAGAGGTGGG + Intergenic
1152365593 17:79854568-79854590 CAGGGAAGGCTCACTGAGGAAGG + Intergenic
1152437225 17:80283738-80283760 CAGGAGGAGCCCACTGAGGCAGG - Intronic
1153488592 18:5627132-5627154 CAAGGGAACTTCACAGAGGATGG - Intronic
1153501226 18:5751968-5751990 AAGGGGAAAGGCACTGAGGAAGG + Intergenic
1153815141 18:8784706-8784728 CAGGTGAACCGCATTGGGGATGG + Exonic
1154215341 18:12411762-12411784 CAGTGGAACACCAGTGGGGAGGG - Intronic
1154341471 18:13505993-13506015 AAGTGGATCCACACTGAGGAGGG - Intronic
1155362318 18:25015795-25015817 CAGGACAAGCCCACTGAGGCTGG - Intergenic
1155413236 18:25568992-25569014 TTGGGCAACCCCACTCAGGAGGG + Intergenic
1156505345 18:37587158-37587180 GAGGGGCAGCCCACAGAGGAAGG - Intergenic
1156585363 18:38425820-38425842 CAGGGGAGGACAACTGAGGAAGG - Intergenic
1158748932 18:60236173-60236195 CAGGGTAACAACAGTGAGGATGG - Intergenic
1159891715 18:73959172-73959194 CAGGCAAACCCCACTGGGGCTGG - Intergenic
1160989908 19:1856254-1856276 CTGGGGAGCCCAGCTGAGGAGGG + Intronic
1161379222 19:3955882-3955904 CGGGGTCACCCCACTGAGGAAGG + Intergenic
1162349256 19:10138808-10138830 CAGGGGACAGCCACTGGGGAAGG + Intronic
1162841985 19:13363557-13363579 GAGGGAAAACCCACTGGGGAAGG - Intronic
1163218138 19:15895631-15895653 CAGGTCAACCCCACAGAGGAGGG - Exonic
1163422354 19:17220901-17220923 CAGTGGACCCCCACTGACGTGGG + Intergenic
1164757696 19:30702643-30702665 CAGGGGAAGCTCAGTGGGGAGGG - Intronic
1165757690 19:38304013-38304035 CAGGGGAGGCCGACTGAGGGGGG - Intronic
1166857205 19:45788429-45788451 CAGGTGAGCCCCAATGAGAAAGG + Intronic
1168098096 19:54126774-54126796 CTAGGAAACCCCACTGGGGAAGG - Intronic
1168327230 19:55544675-55544697 CAGAGTACCCCCACTGAGAAGGG + Intronic
925801869 2:7609654-7609676 GAGGGGAACCACTCTGAGGTGGG - Intergenic
925808168 2:7672965-7672987 CAGGGGCACCTCACTCTGGAAGG + Intergenic
927966845 2:27275669-27275691 CAGCGGAACCCCAGAGAGCAGGG - Intronic
929772363 2:44903086-44903108 CAGCTGAGCCCTACTGAGGAAGG - Intergenic
929781254 2:44958527-44958549 GAGGTGACACCCACTGAGGAGGG - Intergenic
930610460 2:53537265-53537287 CAGGGCAAGCTCATTGAGGAAGG + Intronic
930886132 2:56328983-56329005 CAGGAGGAGCCCACTGAGGAAGG - Intronic
931464403 2:62474007-62474029 CAGGGAGGCCACACTGAGGATGG + Intergenic
936664936 2:114583853-114583875 CAGTGGAACATCAATGAGGAGGG - Intronic
937920668 2:127127330-127127352 CCTGGGAACCCCACTGTGGCTGG + Intergenic
937956743 2:127426075-127426097 CAAGGGAACTTCACTGAGGTAGG - Exonic
942470082 2:176251000-176251022 CAGGGGAACCCTGCAGAGGGCGG - Intergenic
944154264 2:196593659-196593681 CAGCGGGACCTCCCTGAGGAAGG + Intronic
945995534 2:216432839-216432861 CAGGTGAAGCGCACGGAGGATGG - Exonic
946063372 2:216965424-216965446 CCAGGGAACTCCACTGAGAAAGG - Intergenic
946189729 2:218002010-218002032 CACAGGAGCCCCTCTGAGGAAGG + Intronic
948011739 2:234654224-234654246 CAAGGAGAGCCCACTGAGGAAGG + Intergenic
948168432 2:235880801-235880823 CACGGGAATCCCACTGAAGAGGG + Intronic
1170869092 20:20188239-20188261 TGGGGGATCCCCACTGAGAATGG - Intronic
1171849705 20:30299712-30299734 CAGGGGAACCCCAGAACGGATGG + Intergenic
1172881477 20:38202681-38202703 CAGGGGAACCCTAGCGAGCAGGG + Intergenic
1173872293 20:46349772-46349794 CAGTGGGGCCCCACTGGGGAGGG + Exonic
1174458823 20:50668491-50668513 GAAAGGAACCGCACTGAGGAGGG - Intronic
1175912713 20:62412458-62412480 CAAATGAACCCCACAGAGGAGGG - Intronic
1175996734 20:62815341-62815363 CAGGGGAGAGCCACTGAGGAGGG + Intergenic
1176287924 21:5028638-5028660 CACGGGAATCCCACTGCGCACGG + Intronic
1179087901 21:38236734-38236756 CAGGGGCCCTCCACTGAGAATGG + Intronic
1179452972 21:41478175-41478197 CAGGGCAAGCCCAGTGGGGAGGG - Intronic
1179632800 21:42689027-42689049 CACGGGGACCTCGCTGAGGACGG - Intronic
1179869257 21:44234837-44234859 CACGGGAATCCCACTGCGCACGG - Intronic
1180009539 21:45040486-45040508 CAGGGGAACTCCACACAGAAGGG - Intergenic
1181513888 22:23400852-23400874 CAGGGCAACCACAGGGAGGAGGG + Intergenic
1181600934 22:23951594-23951616 CTGGGAACCCCCACTGGGGAGGG + Intergenic
1183433841 22:37782071-37782093 CAGGGGGACGGCAGTGAGGATGG - Intergenic
1184498958 22:44860465-44860487 CAGGGGGTCCACACTTAGGAGGG - Intronic
1184608145 22:45586111-45586133 CAGGGGCCACCCACTGAGCAGGG - Intronic
1185094827 22:48800504-48800526 CTGGGGAACCCACCTGAGGCAGG + Intronic
1185127406 22:49018781-49018803 AAAGCCAACCCCACTGAGGACGG - Intergenic
1185289590 22:50016835-50016857 CAGGCTCACCCCACTGAGAAGGG - Intronic
949931394 3:9081212-9081234 CAGGGGACCAGCACTGGGGAGGG - Intronic
950634039 3:14302836-14302858 CAGGGGAACCCCACACACAAAGG + Intergenic
950686460 3:14621912-14621934 CTAGGGTTCCCCACTGAGGAGGG + Intergenic
953503374 3:43459603-43459625 CAGTGGGACCCTCCTGAGGAAGG + Intronic
953796045 3:45986704-45986726 CAGGGACACCAAACTGAGGATGG + Intronic
957957142 3:87202049-87202071 CAGGGAAAAGCCACTGAGGAGGG + Intergenic
961451589 3:127004672-127004694 CACGGGACCCCCACTGTGGCTGG + Exonic
961821121 3:129576160-129576182 CAGGGGAACCCCGCTGGGAGTGG - Intronic
962311169 3:134327781-134327803 CAGGGGAGCCTGACAGAGGAAGG + Intergenic
962504063 3:136028137-136028159 GAGGGGAAGCCCACTCTGGAGGG - Intronic
965499439 3:169440469-169440491 CAGGAGAAACCCAATGAGCAAGG + Intronic
965846887 3:172973404-172973426 CAGAGGAACCCCACTAAACAGGG - Intronic
968713270 4:2136356-2136378 CAGCTGAACCCCGCAGAGGAAGG + Intronic
968972255 4:3802185-3802207 CTGGGGCACCCCAAGGAGGATGG + Intergenic
969029866 4:4203303-4203325 CAGCTGCAGCCCACTGAGGATGG + Intronic
969445502 4:7242714-7242736 CAGGGGAAAGCCACTTTGGAGGG - Intronic
972136888 4:35903826-35903848 CATGGGACCCCCACAGAGGAGGG + Intergenic
974257214 4:59474258-59474280 CAGGGGCACCCCTCTGATGCAGG - Intergenic
976768205 4:88620768-88620790 CAGGGTAAACACTCTGAGGAGGG - Intronic
977731852 4:100363244-100363266 CAGGGAAAGCCCACTCTGGAAGG - Intergenic
985372538 4:189301633-189301655 CTGGGGAAGCCCAGTGAGGGTGG - Intergenic
985764564 5:1769934-1769956 CTGGCGAACCCCACTGAGCACGG - Intergenic
986041028 5:3994185-3994207 CAGGAAATCCCCACAGAGGATGG + Intergenic
989183710 5:38602942-38602964 CAGGGGCACACCACTGGAGAAGG + Intronic
989353657 5:40516856-40516878 CAGAGAAACCCCAGTGTGGAAGG - Intergenic
993990015 5:94644710-94644732 TAGGTGAACCTCACTGAGTAAGG - Intronic
995829809 5:116343395-116343417 CAGGTAAACCCTACTGGGGAAGG - Intronic
999687664 5:154117195-154117217 CAGGGGACCCATGCTGAGGAGGG + Intronic
1001355897 5:171022508-171022530 CAGGGGAACCCCACCCAGTGAGG + Intronic
1001455796 5:171858752-171858774 CAGGGGGACCCGACTGTGGCCGG - Intergenic
1001856140 5:175012493-175012515 CAGTGGACTCCCACTGAGGGCGG - Intergenic
1002089445 5:176795884-176795906 CAGGGAGCCCCCACAGAGGAGGG - Intergenic
1002288576 5:178182390-178182412 TAGGGAAGCCACACTGAGGAAGG + Intergenic
1002305380 5:178279823-178279845 CAGGGGCACCGCCTTGAGGAAGG - Intronic
1002682223 5:180975539-180975561 TGGGGGAACCCCATAGAGGAAGG + Intergenic
1002946957 6:1771229-1771251 CAGATGCATCCCACTGAGGATGG + Intronic
1005959053 6:30683602-30683624 GAGGGGAAACCCAGGGAGGAAGG + Intronic
1006366549 6:33619597-33619619 CACTGGAACCTCACTGAGAAGGG - Intergenic
1007114678 6:39335247-39335269 CAGGGGAAGCCCCCTGAAGAGGG + Exonic
1008448952 6:51626945-51626967 CAGGAGAGACCCACTGTGGATGG - Intronic
1011050949 6:83149179-83149201 AAGGGGAACTTCACAGAGGAGGG + Intronic
1013417677 6:109939260-109939282 CTGGGAAACACCATTGAGGAAGG + Intergenic
1013609271 6:111778994-111779016 CAGGGAAACCCTTGTGAGGAGGG - Intronic
1015378852 6:132543959-132543981 AAAGGGAACCCCTCTGAGAATGG - Intergenic
1018722064 6:166580684-166580706 CAGTGGGTCCCCAGTGAGGACGG + Intronic
1019341059 7:509160-509182 CAGCGCAACCCCAGGGAGGAAGG + Intronic
1019573993 7:1727463-1727485 CAGGGGCACCCCACTACTGAAGG - Intronic
1019595458 7:1856385-1856407 CAGGGGGCCCCCACAGAGGCTGG - Intronic
1021477655 7:21080718-21080740 CAGGGCCATCCCACGGAGGAAGG + Intergenic
1021891988 7:25195023-25195045 CAGGAAAATCCCACTGAGGTTGG + Intergenic
1022456914 7:30565483-30565505 CAGTGGTACCCAAGTGAGGAAGG - Intergenic
1022601119 7:31760985-31761007 AACGTGAGCCCCACTGAGGATGG + Intronic
1022762143 7:33366151-33366173 CCAGGGAACCCCAGAGAGGAAGG - Intronic
1023393896 7:39734587-39734609 TAGGGGCATCCCACTGAAGAAGG - Intergenic
1023852408 7:44157793-44157815 CAGGGGACCTGCACTGAGGCTGG + Intronic
1024194688 7:47047562-47047584 CAGGGGAACCTCAACAAGGAAGG + Intergenic
1029941172 7:104482169-104482191 CTGGGAAATCCCACTGAGGTCGG + Intronic
1032480358 7:132241083-132241105 CAGGCGACCCCCACTGTGGCTGG - Exonic
1034331626 7:150288116-150288138 CAGGGCTACCCCACAGAGCAGGG + Intronic
1037591214 8:20313535-20313557 CAGGAGAACCTCAAAGAGGAAGG - Intergenic
1038200700 8:25410185-25410207 CAGAGGAACTCCACTGAGGTAGG + Exonic
1038541190 8:28391472-28391494 CAGGGGGAGCCCATTGTGGAAGG - Intronic
1039215996 8:35272297-35272319 CAGGGGAACCCAACCAAGGACGG - Intronic
1039819130 8:41120765-41120787 CAGGGGAGGCCCCCTAAGGAAGG + Intergenic
1040978209 8:53217536-53217558 CAGCGGAAACCCAGTGAGGAGGG - Intergenic
1047513732 8:125535556-125535578 CAGGGCAAGCCCATTAAGGATGG + Intergenic
1049374287 8:142281680-142281702 AAGGGCAACCCCATAGAGGAAGG + Intronic
1054157646 9:61651763-61651785 CAGGGGAACCCCAGAACGGATGG - Intergenic
1054175756 9:61874343-61874365 CAGGGGAACCCCAGAACGGATGG + Intergenic
1054477420 9:65582768-65582790 CAGGGGAACCCCAGAACGGATGG - Intergenic
1054661783 9:67706467-67706489 CAGGGGAACCCCAGAACGGATGG - Intergenic
1059467391 9:114477652-114477674 CAGGGGAAGGACACTGAGAACGG + Intronic
1195010825 X:100731366-100731388 CAGAGGGAGCCCACTGAGGCAGG + Intronic
1197146206 X:123175465-123175487 CTGGGGTAACCCACTGAGGGAGG + Intergenic
1198083927 X:133265483-133265505 CAGTGGAATCCCGCTGAGGCTGG - Intergenic
1199330064 X:146549013-146549035 AAGGGGAACCTAACTGAGGGTGG - Intergenic
1199356548 X:146869315-146869337 CAGGGGCACACCACTGGAGAAGG - Intergenic
1201586015 Y:15562036-15562058 CAGGGGAATCCCCCTTAGAAAGG - Intergenic
1201784396 Y:17758010-17758032 CCGGGGAACCCAACGGTGGAGGG + Intergenic
1201817157 Y:18147977-18147999 CCGGGGAACCCAACGGTGGAGGG - Intergenic