ID: 1126970725

View in Genome Browser
Species Human (GRCh38)
Location 15:54109087-54109109
Sequence GAAACGTCTGTCATTACAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 74
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 69}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126970725 Original CRISPR GAAACGTCTGTCATTACAGG AGG (reversed) Intronic
901582737 1:10258856-10258878 CACATGTCTGTCATTAAAGGTGG + Intronic
914831396 1:151173495-151173517 GAAATGTGTGACATTGCAGGTGG - Exonic
916943744 1:169703063-169703085 GAAATGATTGTCATTAAAGGAGG + Intronic
919938024 1:202267903-202267925 GAAATGCCTCTCATTACAGATGG - Intronic
920652542 1:207849689-207849711 GATACGTGTGTGCTTACAGGGGG + Intergenic
1063403588 10:5771558-5771580 AAAAAGTCTGTCATTATAGGTGG + Intronic
1070447262 10:76518412-76518434 GAAAGGTCTATCATTACATGAGG - Intronic
1073878821 10:107955897-107955919 AAAACGTCTGTTACTACAGCAGG + Intergenic
1075413525 10:122246479-122246501 CCAAGGTCTGTCATTACATGGGG + Intronic
1078549597 11:12271013-12271035 GAAACGTCTGTCCTCACACATGG - Intergenic
1079210767 11:18458590-18458612 GCAACTTCTGTCATTCAAGGAGG + Intronic
1081887386 11:46510028-46510050 GAAATGCCTGTCATCAAAGGTGG + Intronic
1091604085 12:1935633-1935655 GAAACCTCTGTCTATGCAGGAGG + Intergenic
1097396931 12:59086531-59086553 GAGACGTCTGTCAATGGAGGAGG + Intergenic
1098049209 12:66435463-66435485 TAAAAGGCTGTGATTACAGGCGG + Intronic
1099941027 12:89188253-89188275 GATCCCTCTGTCATTACATGAGG - Intergenic
1103137601 12:118521103-118521125 AAAACGTCTGTCACTGCAGCAGG + Intergenic
1104888705 12:132128079-132128101 GAAATGTATGTCCTTGCAGGAGG + Intronic
1106461470 13:29974045-29974067 GGAAAGTCTGTCATGCCAGGCGG + Intergenic
1115103071 14:29726527-29726549 GACACTTATGTCAATACAGGTGG + Intronic
1117544105 14:56777324-56777346 GAATCATCTGACATTGCAGGTGG - Intergenic
1122597512 14:102903594-102903616 GAAACGTTTGTCTTTGCTGGGGG - Intronic
1122945445 14:105006487-105006509 GACAGGACTTTCATTACAGGTGG - Intronic
1123492800 15:20796089-20796111 GAAACTGCTGTCAGTCCAGGTGG + Intergenic
1123549301 15:21365185-21365207 GAAACTGCTGTCAGTCCAGGTGG + Intergenic
1125733160 15:41905620-41905642 GAAACATGTGTCCTTACAGTGGG + Intronic
1125973989 15:43935216-43935238 GAAAGGGCTGGGATTACAGGCGG - Intronic
1126970725 15:54109087-54109109 GAAACGTCTGTCATTACAGGAGG - Intronic
1132080910 15:98864645-98864667 CAAAGGGCTGTGATTACAGGCGG + Intronic
1202957637 15_KI270727v1_random:92401-92423 GAAACTGCTGTCAGTCCAGGTGG + Intergenic
1138726668 16:59147653-59147675 GAAACGTCTTTAATTACATGGGG - Intergenic
1150183404 17:63152391-63152413 GAAACGTCTCTCATTTTATGAGG - Intronic
1151504799 17:74520753-74520775 CAAAGGTCTGGGATTACAGGCGG + Intergenic
1156661747 18:39354228-39354250 CAGACCTCTGTCATTCCAGGTGG + Intergenic
1156742872 18:40354046-40354068 GAAACCTCTGTTATTACATCTGG + Intergenic
1156947133 18:42847995-42848017 GTAATGTCTCTCATTATAGGGGG - Intronic
1167536351 19:50055224-50055246 GGAACGTCTGTCAATATATGGGG - Intergenic
930640950 2:53854020-53854042 GCATCGACTGTGATTACAGGGGG + Exonic
935055105 2:99558931-99558953 GAAACATCCGCCAGTACAGGAGG + Exonic
935377162 2:102411267-102411289 GAAACTTTCCTCATTACAGGAGG + Intergenic
936889320 2:117350640-117350662 CCAACATCTGTCATCACAGGAGG - Intergenic
1170270355 20:14520766-14520788 TAAAAGCCTATCATTACAGGTGG - Intronic
1170300878 20:14883180-14883202 AAAAAGTCTGTAATTACATGTGG + Intronic
950878706 3:16303476-16303498 AAAAAGTCTGTCATTGGAGGTGG - Exonic
953960387 3:47261787-47261809 GACGTCTCTGTCATTACAGGTGG + Intronic
956689362 3:71861616-71861638 GAAACAACTGTAATTACTGGTGG - Intergenic
957906526 3:86563974-86563996 GCAACATCTGTAATTAAAGGAGG - Intergenic
966060155 3:175744180-175744202 TAAGCGTGTGTCATCACAGGAGG + Intronic
969853943 4:9983974-9983996 AAACAGTCTTTCATTACAGGAGG + Intronic
972877409 4:43380468-43380490 GAAAAGTCTGTCAATGAAGGAGG - Intergenic
975859133 4:78657594-78657616 GAAAAGTCTTTCATTTCAGCAGG + Intergenic
981082533 4:140649551-140649573 GAAAAGCCTAACATTACAGGAGG + Intronic
984303641 4:177957169-177957191 GAAAAGGCTGACATTTCAGGAGG + Intronic
987580415 5:19783598-19783620 GAAACCTCTGTCACCACATGGGG + Intronic
990992145 5:61696899-61696921 CAAACTGCTGGCATTACAGGCGG - Intronic
993175022 5:84472509-84472531 GAAATGTCTATATTTACAGGAGG - Intergenic
999289082 5:150411786-150411808 GAGACATCTGCCATCACAGGAGG - Intronic
1013249395 6:108319453-108319475 GAAACCTCTGTCTTTACAGATGG - Intronic
1015018078 6:128438171-128438193 GAAACGTCTGTGATGTTAGGTGG - Intronic
1024763357 7:52627772-52627794 GAAAAGTCTATCAATACTGGGGG - Intergenic
1028533555 7:91865217-91865239 GAAAAGACTGGCATTCCAGGAGG - Intronic
1033039262 7:137903431-137903453 GAAAAGTCTGTAATATCAGGCGG - Intronic
1039513435 8:38110417-38110439 GCAACGTCTGCCATCACAGTGGG + Exonic
1043708579 8:83383610-83383632 GATCCGTCTGTTATTGCAGGTGG - Intergenic
1049729064 8:144166682-144166704 GAAGCGTCTGTGAGTACAAGTGG + Intronic
1050984206 9:12061286-12061308 CAAAAGTCTCTCATTACATGTGG - Intergenic
1051177186 9:14372684-14372706 GAAACATCTGTTATAACATGTGG + Intronic
1185493869 X:539545-539567 CAAAGTTCTGTTATTACAGGAGG + Intergenic
1194900793 X:99508999-99509021 GATATGTAAGTCATTACAGGTGG + Intergenic
1196481430 X:116154566-116154588 CAAACGTTTGCCATAACAGGTGG + Intergenic
1198275527 X:135095122-135095144 GAAACGTATGTCATTCCGGTCGG + Intergenic
1199428177 X:147727571-147727593 GAATCTTCTGTCATTTCAGATGG + Intergenic
1199634308 X:149801460-149801482 GAAAATGCTGTGATTACAGGTGG + Intergenic
1200269140 X:154665019-154665041 CAAAATTCTGGCATTACAGGTGG + Intergenic