ID: 1126975227 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 15:54170610-54170632 |
| Sequence | ATTTCATTTGAACAGGTTAA AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 334 | |||
| Summary | {0: 1, 1: 0, 2: 3, 3: 18, 4: 312} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1126975222_1126975227 | 24 | Left | 1126975222 | 15:54170563-54170585 | CCTTTTTTTTCCTTAAAATATCT | 0: 2 1: 2 2: 17 3: 195 4: 1559 |
||
| Right | 1126975227 | 15:54170610-54170632 | ATTTCATTTGAACAGGTTAAAGG | 0: 1 1: 0 2: 3 3: 18 4: 312 |
||||
| 1126975223_1126975227 | 14 | Left | 1126975223 | 15:54170573-54170595 | CCTTAAAATATCTTATTTTTCTG | 0: 1 1: 1 2: 8 3: 131 4: 941 |
||
| Right | 1126975227 | 15:54170610-54170632 | ATTTCATTTGAACAGGTTAAAGG | 0: 1 1: 0 2: 3 3: 18 4: 312 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1126975227 | Original CRISPR | ATTTCATTTGAACAGGTTAA AGG | Intronic | ||