ID: 1126975227

View in Genome Browser
Species Human (GRCh38)
Location 15:54170610-54170632
Sequence ATTTCATTTGAACAGGTTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 334
Summary {0: 1, 1: 0, 2: 3, 3: 18, 4: 312}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126975222_1126975227 24 Left 1126975222 15:54170563-54170585 CCTTTTTTTTCCTTAAAATATCT 0: 2
1: 2
2: 17
3: 195
4: 1559
Right 1126975227 15:54170610-54170632 ATTTCATTTGAACAGGTTAAAGG 0: 1
1: 0
2: 3
3: 18
4: 312
1126975223_1126975227 14 Left 1126975223 15:54170573-54170595 CCTTAAAATATCTTATTTTTCTG 0: 1
1: 1
2: 8
3: 131
4: 941
Right 1126975227 15:54170610-54170632 ATTTCATTTGAACAGGTTAAAGG 0: 1
1: 0
2: 3
3: 18
4: 312

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126975227 Original CRISPR ATTTCATTTGAACAGGTTAA AGG Intronic