ID: 1126978752

View in Genome Browser
Species Human (GRCh38)
Location 15:54217267-54217289
Sequence TAGGATTGTGGATAAGGGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 243
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 218}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126978752 Original CRISPR TAGGATTGTGGATAAGGGCA AGG Intronic
903110205 1:21126315-21126337 TAGTATTGTGGTTAAGAGTATGG - Intronic
905321829 1:37123149-37123171 GAGCATGGTGGATAGGGGCAGGG - Intergenic
905496445 1:38392500-38392522 TAGCAGTGTGGAAAAGTGCAGGG + Intergenic
905515695 1:38560242-38560264 TAGGATTAGGGTTAAGGGGATGG + Intergenic
906372164 1:45263317-45263339 CAGGATGGTAGATAAGAGCATGG + Intronic
908305142 1:62806620-62806642 TAGGATTGGGGATATAGGAAAGG + Intronic
909510169 1:76443608-76443630 TAGGATTCTTGATGAGGGCAAGG - Intronic
910110876 1:83682058-83682080 TATCAATGTGGATAAGGCCAGGG - Intergenic
911391031 1:97243531-97243553 TAGCATTGTGGTTAAGAGCATGG - Intronic
911519277 1:98909132-98909154 CAGGAATGTGGATAAGGTCATGG + Intronic
912510632 1:110187930-110187952 TGGTATTGTGGATAAGGAAATGG - Intronic
914396469 1:147274073-147274095 TAGTATAGTGGATAAAAGCACGG + Intronic
914880771 1:151545001-151545023 TAGCATTGTGGTCAAGAGCATGG + Intronic
915071455 1:153272419-153272441 TAGGATTGTGGGTAATGCCCTGG + Intergenic
915961211 1:160268401-160268423 TAGGGTTCTGGATGAGGGAATGG - Intergenic
916053180 1:161050062-161050084 TAGGATAGTGGGTAAGAACATGG - Intronic
917105458 1:171486457-171486479 TAGGACTGAAGAAAAGGGCATGG + Intronic
918277092 1:182963661-182963683 TAGCATAGTGGTTAAGAGCAGGG - Intergenic
921341755 1:214140884-214140906 CAGGGTTGTGGAGAAAGGCATGG - Intergenic
924459353 1:244244755-244244777 TAGGGTAGTGGTCAAGGGCATGG - Intergenic
924701807 1:246462143-246462165 TAGCATTGTGAGTACGGGCATGG + Intronic
1063318909 10:5033995-5034017 GAGGTTTGTGGGTGAGGGCATGG - Intronic
1063546019 10:6982527-6982549 TACAATTGTGGAGAAGGGTAAGG - Intergenic
1066655940 10:37700292-37700314 TAGGGATGGGGATTAGGGCAGGG - Intergenic
1067040432 10:42950556-42950578 TAGGGATGGGGATTAGGGCAGGG - Intergenic
1069662698 10:70134049-70134071 AAGAGTTGTGGATAAGGGCCAGG + Intergenic
1071965497 10:90847739-90847761 TAGCTTTGTGTATGAGGGCAGGG - Intronic
1073034469 10:100553654-100553676 TAGGATAGTGTTTAAAGGCATGG + Exonic
1074742561 10:116499353-116499375 CAGCATTGTGGACATGGGCAAGG + Intergenic
1078590016 11:12632288-12632310 TAGGTTTGTAGACAAGGGCAAGG + Intergenic
1079274050 11:19017071-19017093 TAGTAATGGGGATAAGAGCAAGG - Intergenic
1079779532 11:24583415-24583437 TAGCATTTTGGTTAAGAGCAGGG + Intronic
1081112824 11:39157948-39157970 AAGGATTGTGGATATGTGTAAGG - Intergenic
1081960507 11:47133144-47133166 TAGCATTGTGGTTAATAGCATGG - Intronic
1082273099 11:50193261-50193283 TATAATTGTGTATAAAGGCAGGG - Intergenic
1083830759 11:65231811-65231833 TGGGATTGTGGATTTGGGAAAGG + Intergenic
1085610111 11:77939974-77939996 TAGAATTTTTGATAAGGGAAAGG - Intronic
1085635479 11:78156319-78156341 TGGCAGTGTTGATAAGGGCATGG - Intergenic
1086290449 11:85303056-85303078 TAGGATAGTGGTTAAGAGCAGGG - Intronic
1088776093 11:113084725-113084747 TAGCATTGTGGCTGAGAGCATGG + Intronic
1090217813 11:124985008-124985030 TAGGATTGAGGTTAAGGGCAAGG - Intronic
1091017993 11:132071585-132071607 TGGGAGTGTGGGGAAGGGCATGG + Intronic
1091649157 12:2296674-2296696 AAGGAGTGAGGATAAGGGAAAGG + Intronic
1092181632 12:6450710-6450732 TAGGATTAGGGATAAGAGGAGGG + Intronic
1092971919 12:13704311-13704333 AAGGATGGAGGAGAAGGGCATGG + Intronic
1092997575 12:13964385-13964407 AAGGTTTGTGGCCAAGGGCAGGG - Intronic
1094503382 12:31039562-31039584 TAGGATACTGGGTTAGGGCAAGG + Intergenic
1097140187 12:56896060-56896082 AAGGATGGTGGAGGAGGGCAAGG - Intergenic
1097696458 12:62779726-62779748 CAGGATGGTGGTTAAGAGCAGGG - Intronic
1100021904 12:90079078-90079100 TAGGATTGAGGAAAATGGGATGG + Intergenic
1102856393 12:116298258-116298280 TAGGATTGAGGAGATGGGCAAGG + Intergenic
1106079215 13:26486783-26486805 TAAGATTGTGGCTAAGAGGATGG - Intergenic
1108227792 13:48306460-48306482 TAGAATAGTGGTCAAGGGCATGG + Intronic
1110095946 13:71521032-71521054 TAGCATTGTGGCAAAGAGCATGG + Intronic
1112035695 13:95494756-95494778 TAGGATGGTAGATACGGACAGGG + Intronic
1112841260 13:103581312-103581334 TAAGATTGTGGGCAAGGGCATGG + Intergenic
1115432339 14:33334380-33334402 TGGGATTGTGGTTGGGGGCAGGG - Intronic
1115523148 14:34252940-34252962 TAGGATTGTGGAAGAGTACATGG - Intronic
1116868050 14:50047301-50047323 TAGGAGTGTAGAAAAGGACAGGG + Intergenic
1117998112 14:61497165-61497187 TGGCATTGTGGATAAGAGCTGGG + Intronic
1120278828 14:82413049-82413071 CAGGCATGTGGATAAGGGCTGGG + Intergenic
1123857581 15:24429433-24429455 TAGGTTTGTGGATACAGGTATGG + Intergenic
1125186986 15:36942131-36942153 AAGGATTCTGGATGAGGGCTGGG + Intronic
1126875633 15:53038253-53038275 TATGATTGAGGATGTGGGCAGGG + Intergenic
1126978752 15:54217267-54217289 TAGGATTGTGGATAAGGGCAAGG + Intronic
1127658668 15:61079739-61079761 GCTCATTGTGGATAAGGGCAAGG - Intronic
1127776911 15:62270772-62270794 TAGAATGCAGGATAAGGGCATGG + Intergenic
1128851681 15:70964239-70964261 TAGCATAGTGGTTAAGAGCATGG + Intronic
1131765170 15:95668168-95668190 AAGAATTGTGGATAAGGGTTAGG + Intergenic
1132275888 15:100563626-100563648 TAGGGTTGGGGAGAAGGCCAGGG + Intronic
1132920561 16:2388267-2388289 TAGGAATGCAGATAAGAGCATGG + Intergenic
1134800589 16:17080913-17080935 TGAGATTGTAGATATGGGCAGGG - Intergenic
1135729409 16:24881855-24881877 TGGGATTGGAGAAAAGGGCAGGG + Intronic
1136669166 16:31840023-31840045 TGGGATTGTGGATACTGGCCTGG - Intergenic
1137995038 16:53201102-53201124 TAACATTGTGATTAAGGGCATGG - Intronic
1139003755 16:62545824-62545846 CAGGATTGTGAATAACCGCATGG + Intergenic
1139023596 16:62783775-62783797 TATGATAGAGGATAAGAGCATGG - Intergenic
1141233321 16:82191891-82191913 TAATATTTTGGATAAGGCCAAGG + Intergenic
1141492083 16:84380615-84380637 CAGGATTGTGGTTAAGAGCACGG + Intronic
1142021819 16:87788062-87788084 TAAGATTGCTGATAAGGGAAAGG + Intergenic
1142330259 16:89447550-89447572 TAGGATTGTGGACCACAGCAGGG - Intronic
1143419145 17:6775785-6775807 TGGGACAGTGGATAAGGGCCAGG + Intergenic
1143830595 17:9647390-9647412 TAGTATAGTGGTTAAGAGCAAGG + Intronic
1145274784 17:21422942-21422964 TAGGAGTGTGAAGAGGGGCAAGG + Intergenic
1145312635 17:21708841-21708863 TAGGAGTGTGAAGAGGGGCAAGG + Intergenic
1146680829 17:34806817-34806839 TAGCATCATGGCTAAGGGCATGG - Intergenic
1147413751 17:40273517-40273539 TAGAATTGTGGAGGAAGGCATGG + Intronic
1149664662 17:58357488-58357510 TGGCAGTGCGGATAAGGGCATGG + Exonic
1153230323 18:2929090-2929112 TAGGATTGTCTATAAGTCCAGGG + Exonic
1153452544 18:5245625-5245647 TAGGATTGGGGAAAATGGTAAGG + Intergenic
1155422883 18:25674688-25674710 TAGCATTGTGGTTAAGAACACGG - Intergenic
1155555450 18:27014075-27014097 TAGGCTTGTGAATGAGGGCCTGG - Intronic
1157018945 18:43756032-43756054 TACCAGTGTGGATAATGGCATGG + Intergenic
1157558207 18:48627426-48627448 TAGGAGTGAGGATTTGGGCAAGG + Intronic
1162173222 19:8807865-8807887 TAGGGTAGTGGTTAAGTGCATGG + Exonic
1165300107 19:34963454-34963476 TAGGATCCTGAATCAGGGCAGGG - Intronic
1166862624 19:45818830-45818852 TAGCACTGTGGATTGGGGCATGG - Intronic
1167214666 19:48156571-48156593 TAGTGTTGTGGTTAAGAGCACGG - Intronic
925711086 2:6740835-6740857 TTGTATTGTGGAAAATGGCAAGG - Intergenic
927122322 2:19977445-19977467 TAGGATTGGGGATGAGAGGATGG - Intronic
927292620 2:21419869-21419891 TAGGGGTGTGGCTCAGGGCAGGG + Intergenic
928683072 2:33722623-33722645 CAGAATTGTGAATAAGGACAAGG - Intergenic
928997374 2:37307350-37307372 TGGGATTGTGCAAAAGGCCAGGG - Intronic
930298682 2:49587438-49587460 TAGTATAGTGGTTTAGGGCAGGG - Intergenic
931852090 2:66262140-66262162 AAGGATATTGGATGAGGGCAGGG - Intergenic
933642837 2:84782581-84782603 AAGGCTTGTGGGTGAGGGCAGGG - Intronic
935115604 2:100133312-100133334 TGGAATTGTGGATGAGTGCAGGG - Intronic
939113165 2:138031507-138031529 TAGGATAGTGCAGAAGGGGAGGG + Intergenic
941299184 2:163779985-163780007 TAGGATTGTGGCAAAGGGATGGG + Intergenic
941312874 2:163955811-163955833 TTGGAGTGTGGAAAAGGGGATGG + Intergenic
941968808 2:171328007-171328029 TGGGGTTGAGGATAAAGGCAAGG + Intronic
942133686 2:172905027-172905049 TAGGGTGGAGAATAAGGGCAAGG - Intronic
942528013 2:176876326-176876348 TAGGATGGTGGTTAAGAGTATGG - Intergenic
943878235 2:193102137-193102159 TAGGATTGTGGGTAATGGCATGG + Intergenic
944527157 2:200630843-200630865 TAGGAGTGGGGGTAAGGGGAGGG + Intronic
945437380 2:209834924-209834946 AAGCATTGTGGATAAAGGCCAGG + Exonic
945893514 2:215456441-215456463 TAGTAAAGTGGCTAAGGGCATGG + Intergenic
947175253 2:227359925-227359947 AAGAATTTTGGATAAGGGCTGGG - Intergenic
948696124 2:239733755-239733777 GAGGATTGGGGCTAAGGACATGG - Intergenic
1169531946 20:6494732-6494754 TAGGCTTGTGGAAGAGGTCAGGG + Intergenic
1169942920 20:10957099-10957121 TGGGAATGGGGAAAAGGGCAAGG - Intergenic
1170536867 20:17349246-17349268 TAGGATTGTGGATGAGAGCTTGG - Intronic
1175768546 20:61607974-61607996 TAGGAATGTGGATGAGGGAAAGG - Intronic
1177708505 21:24740059-24740081 TAGGATAGTGAATAAGGCCCAGG - Intergenic
1178348346 21:31851257-31851279 GAGGATTCTGAATAAGAGCATGG - Intergenic
1179189840 21:39114455-39114477 TAGGTTTCTAGATAAGGGCCCGG + Intergenic
1179192312 21:39133867-39133889 TAGGAGTGGGGAAAAGGGAAGGG + Intergenic
1180735892 22:18017144-18017166 TGGGATTGTGGACAAGGGAGAGG - Intronic
1185095303 22:48803141-48803163 TGGGATCGTGGATAAGGGAGGGG + Intronic
949536578 3:5000765-5000787 TAGTACTGTGGTTAAGGGCAAGG - Intergenic
950602085 3:14043884-14043906 TAGGCATATGGATGAGGGCAGGG + Intronic
951517871 3:23581670-23581692 TAGCATAGTGGAAAAGGGCATGG - Intronic
952658339 3:35814858-35814880 TAGGAGTGTCGATATGGGGAGGG + Intergenic
953042921 3:39270703-39270725 AAGGATTGAGGATATGGGAAAGG + Intronic
953162159 3:40431018-40431040 TAGGATACTGGGTAAGGGAAGGG + Intergenic
953411702 3:42693846-42693868 TGGGAGTGTGGGAAAGGGCAGGG + Intronic
955617868 3:60827997-60828019 TTGGATAGTGGTTAAGGACATGG + Intronic
955947606 3:64210273-64210295 AAGTATTGTGGCTAGGGGCAGGG - Intronic
956368198 3:68529242-68529264 TAGAATTGTGAAGAAGGGCAGGG - Intronic
957853495 3:85842673-85842695 TAGGATTGAGGATAAAGAGAGGG + Intronic
958264806 3:91425553-91425575 TAGGAATGTTGTTAAGGGCAGGG + Intergenic
959304731 3:104647353-104647375 CAGCTTTGTGGATCAGGGCACGG - Intergenic
960517903 3:118622637-118622659 TGGCATTGTGGTTAAGAGCATGG - Intergenic
960829350 3:121829910-121829932 TAGTATAGTGAATAAGGCCAGGG + Intronic
961367814 3:126412396-126412418 CAGGTTTGGGGATTAGGGCACGG + Intronic
961974591 3:131010092-131010114 TAGGATTATGGAGTAGGGCCAGG + Intronic
962682607 3:137815602-137815624 TACAACTGTGGTTAAGGGCAGGG - Intergenic
962962249 3:140321604-140321626 TAGCAGTGAGGATAAGGGCAGGG + Intronic
964230864 3:154465538-154465560 TAGGATTGTATATAAGGACCAGG + Intergenic
966022646 3:175234738-175234760 TGGCATTGTGGTTAAGTGCAAGG + Intronic
966144128 3:176790613-176790635 TAGCATTGTGGTTAAAGGTATGG + Intergenic
967882964 3:194314563-194314585 TGGGAATGGGGATAAGGGGATGG + Intergenic
968614479 4:1571179-1571201 TAGGAGTGTGGGTAGGGCCATGG + Intergenic
969841047 4:9882247-9882269 GAGAATTGAGGATAAGGGGAGGG - Intronic
970418710 4:15884292-15884314 AAGGTTTGGGGGTAAGGGCAGGG - Intergenic
972374859 4:38460572-38460594 TAGGAATGTGGATCAGGGCTAGG - Intergenic
973658643 4:53078762-53078784 CAGCATTGTGGATAAGACCATGG - Intronic
974596839 4:64024497-64024519 TAGAATTGGGGTTGAGGGCAGGG - Intergenic
976071683 4:81247868-81247890 TATGATTGTGTATATGGGCAAGG - Intergenic
977764739 4:100783768-100783790 TATGATTACTGATAAGGGCATGG - Intronic
978637932 4:110833217-110833239 TAGCATTGTGGATAAGGACCAGG - Intergenic
979793586 4:124816498-124816520 GAGAATTGTGGATAACTGCATGG + Intergenic
981405886 4:144368758-144368780 TAGAATTGTTGCTTAGGGCAGGG + Intergenic
983817375 4:172148650-172148672 TAGGATTGGTGAGAAGGGCAAGG - Intronic
985027348 4:185751225-185751247 TAGGATTGAGGTAAAGGACAGGG + Intronic
986320267 5:6625780-6625802 GAGGATTGTGAATAGGAGCAGGG - Intronic
986651353 5:9966399-9966421 TTGGAATGTGGATAAGAGGAGGG + Intergenic
989465578 5:41751461-41751483 TAGCATAGTGGTTAAGTGCATGG + Intronic
990155576 5:52873311-52873333 TGTGTTTGTGGAGAAGGGCAAGG - Intronic
990279359 5:54232821-54232843 AAGGATGGTGTATGAGGGCAGGG - Intronic
990519264 5:56562346-56562368 TAGCATAGTGAATAAGAGCAAGG + Intronic
990674982 5:58173928-58173950 TAGGATCGTGGATCAGGGCTGGG - Intergenic
991281903 5:64923972-64923994 TAAGATTGTCTATAAGGGTAGGG - Intronic
991519605 5:67481104-67481126 AAGGACTGTGAAGAAGGGCATGG + Intergenic
994264197 5:97695427-97695449 AAGGATAGTGGGTGAGGGCAAGG + Intergenic
998128445 5:139639215-139639237 TAGGACTATGGAAAAGGGTAGGG - Intergenic
998662884 5:144260234-144260256 TGGGATTGTGGATATGGTCTAGG + Intronic
999202635 5:149826930-149826952 TAGGTTTCTGGTTCAGGGCATGG + Intronic
999617132 5:153436485-153436507 TAGCACTGTGGATAAAGGCCAGG - Intergenic
1004299472 6:14444122-14444144 TAGAATTGTGGATAGGGCCTGGG - Intergenic
1004409022 6:15363038-15363060 TATGATTGGAGATAAGGGGACGG + Intronic
1007721659 6:43888800-43888822 GAGGATGGTGGATCTGGGCATGG - Intergenic
1008011594 6:46473713-46473735 TTTGACTGTGGATAAGGGAAAGG + Intronic
1008990579 6:57597107-57597129 TAGGAATGCTGTTAAGGGCAGGG - Intronic
1009179152 6:60495653-60495675 TAGGAATGCTGTTAAGGGCAGGG - Intergenic
1009494146 6:64328166-64328188 TAGGATTGTGAATTAGGAAATGG - Intronic
1009806964 6:68611785-68611807 TAGTACAGTGGTTAAGGGCAAGG - Intergenic
1014926270 6:127274774-127274796 TAGAATTGTGGGTAAAGGCTGGG + Intronic
1016463610 6:144304369-144304391 TAGGCTTGTGGATTGGCGCATGG + Intronic
1023125241 7:36948737-36948759 TAGGAAGGTGGTTAAGAGCATGG - Intronic
1024487756 7:49938631-49938653 TTCTATTGTGGATAAGGGGATGG + Intronic
1024573171 7:50742424-50742446 TAGGATCCTGGTTAAGAGCATGG - Intronic
1025839201 7:65128328-65128350 AAGGGATGTGGATAAGGGCCAGG - Intergenic
1025842989 7:65169006-65169028 TAGAATTTTTGATAAGGGAAAGG + Intergenic
1025880055 7:65526962-65526984 TAGAATTTTTGATAAGGGAAAGG - Intergenic
1025883867 7:65567637-65567659 AAGGGATGTGGATAAGGGCCAGG + Intergenic
1025889578 7:65634969-65634991 AAGGGATGTGGATAAGGGCCAGG - Intergenic
1025893382 7:65675642-65675664 TAGAATTTTTGATAAGGGAAAGG + Intergenic
1026096777 7:67352820-67352842 TAGGGTTAGGGATAAGGGTAGGG - Intergenic
1026363100 7:69620896-69620918 CAGGTTTGGGAATAAGGGCAGGG + Intronic
1028290708 7:89061566-89061588 CACTATTGTGGATAAGAGCAGGG + Intronic
1028531718 7:91845673-91845695 TAGGATCCTGAATATGGGCAAGG + Intronic
1029306958 7:99626579-99626601 TAGGATCCTGGCTAAGGGCCTGG + Intronic
1030420575 7:109302278-109302300 CAGCATTGTGGACATGGGCAAGG - Intergenic
1030817061 7:114051325-114051347 AAGAATTGTAGCTAAGGGCAAGG + Intronic
1031797687 7:126196977-126196999 TAAGATTGTATATAAGGGAAGGG + Intergenic
1032512363 7:132482012-132482034 TAGTAGTGTGGAAAAGGACACGG - Intronic
1033621636 7:143067116-143067138 TAGAATTGTGGATAAAGGGTTGG + Intergenic
1033669508 7:143477800-143477822 CAGGACTGTGGCTAGGGGCAGGG + Intergenic
1035209378 7:157316550-157316572 TAATTTTGTGGATAAGGGCTTGG - Intergenic
1036620954 8:10424414-10424436 TAGGATCGGGGAGAAGGGCCTGG + Intronic
1036620984 8:10424502-10424524 TAGGATCGGGGAGAAGGGCCTGG + Intronic
1037138814 8:15495597-15495619 TAGAATTGTGCATTAGGGGAGGG - Intronic
1037601182 8:20395438-20395460 TAAGATCTTGGCTAAGGGCAAGG + Intergenic
1038463996 8:27743137-27743159 TTGGATTGAGGCAAAGGGCAGGG - Intronic
1042721738 8:71833814-71833836 TAGGATGGTGGTTAAGAACATGG - Intronic
1045264100 8:100604435-100604457 AAGCATGGTGGAGAAGGGCAAGG + Intronic
1046102954 8:109635580-109635602 CAGGATTGGGGAGAAGGGCAGGG - Intronic
1046695873 8:117338521-117338543 TATGATTTTGGATAAGACCAAGG + Intergenic
1047071530 8:121349368-121349390 TAGCACTGTGGCTAAGGGTATGG + Intergenic
1047314980 8:123724576-123724598 TAGCATCTTGGATAAGGTCAAGG - Intronic
1047550218 8:125863342-125863364 TGGAAATGTGGATGAGGGCAAGG + Intergenic
1049030028 8:140028215-140028237 TTGGATTGAGGAAAAGGGCTTGG - Intronic
1050361594 9:4836019-4836041 TGGGATTGAGGGTAAGGGGATGG + Intronic
1056733408 9:89184635-89184657 TAGGAGTGTGTTTAGGGGCAGGG + Intergenic
1057479732 9:95435198-95435220 TTGGTTTGAGGATAAGAGCATGG - Intergenic
1057750610 9:97789663-97789685 TAGGATTGTGAATTATTGCAAGG - Intergenic
1058354841 9:104072391-104072413 TATGATTGTGTATAAGACCAGGG + Intergenic
1059954567 9:119502031-119502053 TTGGATCGAGGTTAAGGGCAAGG + Intronic
1060273242 9:122162814-122162836 GAGGATTGTGGGCAGGGGCAAGG + Intronic
1060540482 9:124426808-124426830 AAGGGTTCTGGCTAAGGGCAGGG - Intergenic
1061245110 9:129397564-129397586 TTGGATGATGGATAAGGGGATGG + Intergenic
1188505804 X:30883497-30883519 TAGTATAGTGGTTAAGCGCATGG - Intronic
1189131896 X:38507900-38507922 TAGCTTTGTGGTTAATGGCATGG - Intronic
1189737855 X:44089646-44089668 AAGGATTGGGGATAAAGGGATGG + Intergenic
1190486364 X:50929005-50929027 TAGTATCGTGGTTAAGAGCAGGG - Intergenic
1192502516 X:71663236-71663258 CATGATTGTGGAAAGGGGCATGG + Intergenic
1192509719 X:71714612-71714634 CATGATTGTGGAAAGGGGCATGG + Intronic
1192516978 X:71766941-71766963 CATGATTGTGGAAAGGGGCATGG - Intronic
1198526331 X:137504962-137504984 TAGGATCCTGGATCAGGGCCTGG - Intergenic
1198589705 X:138163639-138163661 TTTAATTGTGGATAATGGCATGG - Intergenic
1198700560 X:139392911-139392933 TAGTATGGTGGATAAGAGCATGG + Intergenic
1201061568 Y:10051157-10051179 TATGCTTGTGGATAAAGGTAGGG + Intergenic