ID: 1126981253

View in Genome Browser
Species Human (GRCh38)
Location 15:54246259-54246281
Sequence ACATATAGACTACACTGGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 75}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126981253_1126981257 -5 Left 1126981253 15:54246259-54246281 CCTCCCCAGTGTAGTCTATATGT 0: 1
1: 0
2: 0
3: 5
4: 75
Right 1126981257 15:54246277-54246299 TATGTTGTGCTTGCCTACAAAGG 0: 1
1: 0
2: 0
3: 8
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126981253 Original CRISPR ACATATAGACTACACTGGGG AGG (reversed) Intronic
901365241 1:8742072-8742094 ATATACATACTACACTGGGATGG - Intronic
907100374 1:51828101-51828123 ACATATAAACTACACCTGAGTGG + Intronic
907680904 1:56562363-56562385 GCATAAAGAATACACGGGGGAGG + Intronic
909222087 1:72978143-72978165 AAATATAGACTACACTTTTGAGG + Intergenic
909352090 1:74665835-74665857 ACATATAAATTACAGTGGGAGGG + Intronic
910036633 1:82796750-82796772 GGATATAGACTACACTTGAGTGG - Intergenic
920541305 1:206780163-206780185 ACATAAATACTACAGAGGGGTGG - Intergenic
1072141054 10:92589546-92589568 ACATATAAAGTACACTGGCTGGG - Intergenic
1080202254 11:29686023-29686045 ACATACAGAATACACTTGGAAGG - Intergenic
1080395218 11:31883642-31883664 ACAAATGGACTACTCTGGTGGGG + Intronic
1081416151 11:42818528-42818550 CCCTATAGACCACACCGGGGTGG + Intergenic
1082282889 11:50289346-50289368 ACATATATACTAAAATTGGGGGG + Intergenic
1101196340 12:102386654-102386676 GCATATAGATTAGACTGGGGTGG + Intergenic
1101366919 12:104081053-104081075 ACATAAAGCCTACACTGGGCAGG - Intronic
1104083781 12:125456699-125456721 ACAGAGAGACTGCAGTGGGGAGG - Intronic
1104260794 12:127180299-127180321 ACAAGTAGACTACTCTGGTGAGG - Intergenic
1109501518 13:63241936-63241958 ACAAATATACTACTCTGGTGGGG + Intergenic
1109665081 13:65523935-65523957 AAAAATAGACTTCACTTGGGAGG + Intergenic
1114927809 14:27426773-27426795 AGATAATGATTACACTGGGGTGG + Intergenic
1114976566 14:28107890-28107912 ACATAGAAATTACATTGGGGTGG - Intergenic
1118697700 14:68400645-68400667 ACAGATAGAACACACTGTGGGGG + Intronic
1120011733 14:79423213-79423235 ACATATCAACTACTCTGGGTTGG + Intronic
1123482901 15:20651043-20651065 ACAAATATACTACTCTGGTGAGG - Intergenic
1126981253 15:54246259-54246281 ACATATAGACTACACTGGGGAGG - Intronic
1130385935 15:83412281-83412303 ACCTATAGATTACTTTGGGGAGG + Intergenic
1133804548 16:9114743-9114765 GAATATAGATTACACTTGGGTGG + Intronic
1134377394 16:13690253-13690275 ACATATAGACTACCCTTGAAAGG + Intergenic
1136916100 16:34199421-34199443 ACATAAAAACTACACAGGGCCGG - Intergenic
1137081866 16:36071905-36071927 ACATAAAGACTACACAGAGAGGG + Intergenic
1140430741 16:74900820-74900842 AAAAATACACTACACTGGGCCGG + Intronic
1141010476 16:80392494-80392516 AAATATATACTATACTGGTGAGG + Intergenic
1141352055 16:83307056-83307078 ACATATAAGCTACAGTTGGGTGG + Intronic
1149148812 17:53534141-53534163 ACATATGGATTTCACGGGGGAGG - Intergenic
1153066145 18:1047139-1047161 ATATATAGACTCCATGGGGGTGG + Intergenic
1155086570 18:22464545-22464567 ACAGATAGATTAGAGTGGGGAGG - Intergenic
1158215750 18:55098925-55098947 ACATACAGACAACACTGTGCTGG + Intergenic
1159586033 18:70284467-70284489 ACATAGAGAGAACTCTGGGGAGG - Intergenic
1159688193 18:71449873-71449895 ATAAAGAGACTACAATGGGGGGG - Intergenic
1159771550 18:72551572-72551594 ACATATAGACTTCAGTGATGGGG - Intronic
1162439330 19:10682898-10682920 TCCTATAGGCTACACTGGGGTGG + Intronic
926209888 2:10862052-10862074 ATGTAAAGACTGCACTGGGGAGG - Intergenic
933352569 2:81173522-81173544 ACAAATACACTACTCTGGTGGGG - Intergenic
933382502 2:81567208-81567230 ACATATAGAAAACAGTGTGGAGG + Intergenic
935051314 2:99527349-99527371 ACAAATGGACCACTCTGGGGAGG + Intergenic
939316436 2:140556320-140556342 ACGTATAGAGTACATTGTGGGGG - Intronic
939414426 2:141875699-141875721 AAATATAGACTACCCTTGTGGGG - Intronic
944925506 2:204459954-204459976 AAATATATTCTACACTTGGGGGG - Intergenic
1173830045 20:46077230-46077252 ACATACAGACAGCACTGGAGAGG - Intronic
1174373099 20:50107106-50107128 ACAGCCAGACTACACTTGGGCGG - Intronic
1178977219 21:37230669-37230691 ACAGAAACACTTCACTGGGGTGG - Intronic
1179775990 21:43662888-43662910 AAATATTGACTAAAATGGGGAGG + Intronic
964649315 3:158993045-158993067 ATATAGAGACTTCACTGGAGGGG + Intronic
970108666 4:12613378-12613400 AGAAATAGTCTACATTGGGGAGG + Intergenic
970219048 4:13789240-13789262 ACATATGGTCTACCCTGGAGAGG + Intergenic
972832467 4:42830819-42830841 ACATGTTGACTACTCGGGGGAGG + Intergenic
975977109 4:80112111-80112133 ACAAATATACTACTCTGGTGGGG + Intronic
979293459 4:119003651-119003673 ACATAGAGACTATACTGGGAGGG - Intronic
983632057 4:169859624-169859646 ACATATAAACAACAGTGAGGTGG - Intergenic
995239208 5:109866595-109866617 ACATACAGACTACGCTTGGAAGG - Intronic
995494683 5:112728425-112728447 ACATATAAAATACACTGGTCGGG - Intronic
999226453 5:150028862-150028884 AAATAAAGAAGACACTGGGGAGG - Intronic
999945574 5:156591670-156591692 ACACATAGACTACACAGAGGGGG + Intronic
1004112173 6:12729705-12729727 ACATACAGGACACACTGGGGAGG + Intronic
1005522840 6:26614917-26614939 ATATTTAGAATTCACTGGGGAGG + Intergenic
1015757188 6:136619543-136619565 ACAAATGGACTACTCTGGTGGGG - Intronic
1020372747 7:7452086-7452108 AAATATATACTCCACTAGGGTGG - Intronic
1023380859 7:39607224-39607246 GGACATAGACAACACTGGGGAGG - Intronic
1024962969 7:54996815-54996837 ACATAGAGAATGAACTGGGGGGG - Intergenic
1027798012 7:82718103-82718125 CCAAAGAGACTATACTGGGGTGG - Intergenic
1028077106 7:86530328-86530350 CCTTATAGAATACATTGGGGAGG + Intergenic
1049865350 8:144932084-144932106 TCAAATAGTCCACACTGGGGAGG - Exonic
1050152289 9:2628749-2628771 AAAGATAGACTACACAGGGAGGG + Intronic
1053241913 9:36502776-36502798 ACATATAGACCATACTGGTCAGG + Intergenic
1055122549 9:72678989-72679011 AAATATAGACTTCAGTGGGATGG - Intronic
1185922771 X:4112622-4112644 ACATATTGAGTACCCTGAGGAGG - Intergenic
1188290290 X:28379430-28379452 ACAAATGGAATACACTGAGGAGG - Intergenic
1188378589 X:29463965-29463987 ACATAAAGACTGGACTGGGCTGG - Intronic
1190617667 X:52252833-52252855 ACAAATGTACTACTCTGGGGGGG - Intergenic
1196370172 X:114968818-114968840 ATATATAGATTACTTTGGGGAGG - Intergenic
1197755869 X:129994242-129994264 ACCCATAGCCTACACTGCGGTGG - Intronic
1200296965 X:154929652-154929674 ACAGATAGACTACAATGAGAAGG - Exonic