ID: 1126981257

View in Genome Browser
Species Human (GRCh38)
Location 15:54246277-54246299
Sequence TATGTTGTGCTTGCCTACAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 102}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126981255_1126981257 -9 Left 1126981255 15:54246263-54246285 CCCAGTGTAGTCTATATGTTGTG 0: 1
1: 0
2: 0
3: 5
4: 91
Right 1126981257 15:54246277-54246299 TATGTTGTGCTTGCCTACAAAGG 0: 1
1: 0
2: 0
3: 8
4: 102
1126981253_1126981257 -5 Left 1126981253 15:54246259-54246281 CCTCCCCAGTGTAGTCTATATGT 0: 1
1: 0
2: 0
3: 5
4: 75
Right 1126981257 15:54246277-54246299 TATGTTGTGCTTGCCTACAAAGG 0: 1
1: 0
2: 0
3: 8
4: 102
1126981254_1126981257 -8 Left 1126981254 15:54246262-54246284 CCCCAGTGTAGTCTATATGTTGT 0: 1
1: 0
2: 0
3: 6
4: 110
Right 1126981257 15:54246277-54246299 TATGTTGTGCTTGCCTACAAAGG 0: 1
1: 0
2: 0
3: 8
4: 102
1126981256_1126981257 -10 Left 1126981256 15:54246264-54246286 CCAGTGTAGTCTATATGTTGTGC 0: 1
1: 0
2: 0
3: 3
4: 68
Right 1126981257 15:54246277-54246299 TATGTTGTGCTTGCCTACAAAGG 0: 1
1: 0
2: 0
3: 8
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126981257 Original CRISPR TATGTTGTGCTTGCCTACAA AGG Intronic
903983425 1:27206385-27206407 TAGATTGTGCTTTCCTAAAACGG - Intergenic
907150920 1:52286853-52286875 AATGTTTTGTTTGGCTACAATGG - Intronic
913259859 1:116988211-116988233 TATGTTTTGCTTTCCTAATAGGG + Exonic
915293632 1:154903905-154903927 TATGTTGTGCTTATATAAAAGGG - Intergenic
916148753 1:161765410-161765432 TTTGTTTTGCTTACCTACCATGG + Intergenic
917585368 1:176421247-176421269 TATCTTGTGCTGGTTTACAAGGG + Intergenic
918776091 1:188632705-188632727 CATGTTGTGCATTTCTACAAGGG - Intergenic
921100403 1:211923802-211923824 TGTGTTGTGCTGGCCTAGAATGG - Intergenic
921957578 1:221000102-221000124 TATATTGGGCTTCCCTACACAGG - Intergenic
1071241375 10:83709252-83709274 TTTGTTGTCCTTTGCTACAATGG - Intergenic
1074437942 10:113450371-113450393 TATATTGTGTTTGCCTTCTAAGG + Intergenic
1074926749 10:118080802-118080824 TGTGTTGTGCATGCCTGCATAGG - Intergenic
1077913251 11:6592772-6592794 TATTTTGTTCTTGGCTTCAATGG + Intronic
1080040641 11:27756139-27756161 AATGTGGTACTTGCATACAATGG - Intergenic
1080930031 11:36800287-36800309 TATTGTGAGCTTCCCTACAAAGG + Intergenic
1087190373 11:95248132-95248154 TATGTTTTCCGTGCCTCCAAAGG + Intergenic
1087405236 11:97722032-97722054 TATTTTGTGTTTGGCTACCAGGG - Intergenic
1088472700 11:110203141-110203163 AATGTGGTACTTGCATACAATGG + Intronic
1094545448 12:31400406-31400428 TATTTTGTACTTGTCCACAAAGG - Intronic
1095888858 12:47216979-47217001 TATGTTGTGGTTGACCACAAAGG + Intronic
1098833329 12:75390456-75390478 TATTTTGTGGTTTCCCACAAAGG + Intronic
1102504117 12:113373089-113373111 GGTGTTTTGCTTGCATACAAGGG + Intronic
1105699382 13:22924862-22924884 TATTTTGTGCCTGCCAATAAAGG - Intergenic
1106333095 13:28757339-28757361 AATGTTGTACATACCTACAAAGG - Intergenic
1106440001 13:29757935-29757957 TCTCTTGTGCTTGTCTCCAATGG + Intergenic
1107089706 13:36464761-36464783 GATGTTGGTCTTGCCTAAAATGG - Intergenic
1107333749 13:39331003-39331025 AATGTTTTGCTTTCCTCCAATGG - Intergenic
1108794680 13:54016957-54016979 TATGTGGTGCTTGCCTAAATGGG + Intergenic
1110359466 13:74609148-74609170 TACTTTGTGCTTGCATCCAAAGG - Intergenic
1114567127 14:23640848-23640870 TATGTTGTTAATGCCTCCAAAGG + Intronic
1117935145 14:60895577-60895599 TATATTCTGTTTTCCTACAAAGG + Intronic
1125008278 15:34842203-34842225 TTTGTTGTGTTTACCTAGAAGGG - Intergenic
1126981257 15:54246277-54246299 TATGTTGTGCTTGCCTACAAAGG + Intronic
1127792578 15:62411498-62411520 TATCCTGAGGTTGCCTACAAGGG - Intronic
1129930140 15:79403736-79403758 TAGGTTGTGATTCCCAACAAGGG - Intronic
1131437157 15:92432233-92432255 TCTGTTGTGCGTGCCTACTGAGG + Intronic
1133475771 16:6120435-6120457 TATGTTGTGCTTTCCTAAGGGGG + Intronic
1158117914 18:54017091-54017113 TATGTTTTGTTTGCATTCAATGG + Intergenic
1159067024 18:63581369-63581391 GATGTTGTGCATGACTTCAAGGG + Intergenic
1160306511 18:77744606-77744628 TTTGTTGTGCCTCCCAACAATGG - Intergenic
1161609770 19:5235878-5235900 TATGTGTTGCGTGCCTACTATGG + Intronic
1165820864 19:38675158-38675180 TAGTTTGTGCTTGTCTACAAAGG - Intronic
925138456 2:1535160-1535182 TTTGGTGTGGTTGCCCACAATGG - Intronic
927301226 2:21517939-21517961 AATGTGGTGCATGCATACAATGG + Intergenic
927418727 2:22907096-22907118 TGTGTTGTGCTTGCAGAGAATGG + Intergenic
929767298 2:44856549-44856571 TATCTTGTTCTTGACTTCAAAGG - Intergenic
930569840 2:53071667-53071689 TATGTTGTGTTTCTCTACATAGG - Intergenic
933860903 2:86466606-86466628 TAAGGAGTGCTTACCTACAAAGG + Exonic
934602884 2:95671674-95671696 TATGGCTTGCTGGCCTACAAAGG + Intergenic
935185788 2:100731674-100731696 TATGTTGCCATTGCCTAGAAAGG - Intergenic
936536264 2:113313868-113313890 TATGGCTTGCTAGCCTACAAAGG + Intergenic
936868405 2:117104676-117104698 TATTTTGTGCTGGCTTTCAAAGG + Intergenic
941406230 2:165092240-165092262 TAAGCTGTTCTTACCTACAATGG + Exonic
942339429 2:174927715-174927737 AACGTTGTTCTTGCCTACAGTGG + Intronic
946625406 2:221606944-221606966 TATGTAGTGGTTGCCTAAATAGG - Intergenic
1169224571 20:3847921-3847943 TAGGATGTGCCTGTCTACAATGG + Intronic
1170529771 20:17279298-17279320 TCTGTTATCTTTGCCTACAATGG + Intronic
1170576797 20:17669426-17669448 TAAGATGTGCTAGCCCACAAGGG + Intronic
1174526853 20:51179241-51179263 TAGGTTGTACCTACCTACAATGG - Intergenic
1178038850 21:28616604-28616626 AATTTTGAGCTTTCCTACAATGG - Intergenic
1180820439 22:18823544-18823566 TATAATTTGCTTGCATACAACGG - Intergenic
1181206663 22:21258016-21258038 TATAATTTGCTTGCATACAACGG - Intergenic
1183163882 22:36132931-36132953 TATGTTCTACTTGCATCCAAAGG + Intergenic
1203220261 22_KI270731v1_random:37407-37429 TATAATTTGCTTGCATACAACGG + Intergenic
1203270565 22_KI270734v1_random:49419-49441 TATAATTTGCTTGCATACAACGG - Intergenic
952190844 3:31021606-31021628 AGGGTTGTGCTGGCCTACAATGG - Intergenic
952583211 3:34859786-34859808 AATGTTGTGTATGCATACAATGG + Intergenic
955152479 3:56381980-56382002 TATGAAGTACTTGCCAACAAGGG - Intronic
962862176 3:139414485-139414507 TATTTTGTGTTTGGCTACCAGGG + Intergenic
963026922 3:140928935-140928957 TATGTTGTACATACATACAATGG - Intergenic
963167644 3:142221914-142221936 TATTTTGTTCTTGTCTACAAAGG + Intronic
965175564 3:165326216-165326238 TATGTTGTACTTATATACAATGG - Intergenic
965958666 3:174402862-174402884 TATGTTGTGCTGGTTTTCAAGGG - Intergenic
970752933 4:19387326-19387348 TATATTGTGCTTGCACACAGTGG + Intergenic
971958674 4:33456218-33456240 TATTTTGTGGTTGCCTTCTAGGG - Intergenic
972989336 4:44804309-44804331 TATGTAGTGCATGCCTTCTATGG + Intergenic
974444455 4:61961336-61961358 TATATTTTGCTTGCATACAATGG + Intronic
975304085 4:72828227-72828249 TATTTTGTGCTTTCTTACATGGG - Intergenic
975733131 4:77356957-77356979 TGGGTTGTGCTTCCCTGCAAGGG - Intronic
976176232 4:82355560-82355582 TATGTAGTGAATGCATACAATGG + Intronic
976345713 4:83997683-83997705 TAGAATGTGGTTGCCTACAAGGG + Intergenic
976505149 4:85837720-85837742 TATGGTGTGCTTGCTGACACTGG - Intronic
981281242 4:142962002-142962024 TCTGTGGTGCTTCCTTACAAGGG + Intergenic
986207071 5:5634980-5635002 TATGCTGTGCATGCCTGCGATGG - Intergenic
986575295 5:9206149-9206171 TATTTTCTTCTTGTCTACAATGG + Intronic
987785827 5:22497488-22497510 GTTGTTGTACTTGCCTAAAAAGG + Intronic
988452153 5:31354092-31354114 TATGTTTTGCTTGAAAACAATGG - Intergenic
993741013 5:91539716-91539738 TATGTGGTATCTGCCTACAATGG - Intergenic
996427539 5:123331424-123331446 TATGTTGTGCTGGTTTTCAAAGG + Intergenic
1005188003 6:23184186-23184208 TGTGTTGTAATTGCATACAATGG - Intergenic
1006028263 6:31161232-31161254 TTTCTTGTGCTTTCCTACAAAGG - Intronic
1009267116 6:61569307-61569329 TCTTTTGTGTTTGGCTACAAGGG - Intergenic
1012277835 6:97295214-97295236 TTTGTTGTGCATGCTGACAATGG + Intergenic
1012705419 6:102522355-102522377 GATGTAGTGCTTGCTTACAGAGG + Intergenic
1013363365 6:109415585-109415607 GATGTTGTGCTTGACTTCACGGG - Intronic
1014544149 6:122713352-122713374 TATGTTATGTTTGCCAACCAAGG - Intronic
1023327741 7:39078347-39078369 TATTCTCTGCTTGCATACAAAGG + Intronic
1026125034 7:67572001-67572023 GATGTGGTCCTTGCCTTCAAGGG + Intergenic
1027382919 7:77630642-77630664 TATGTAGTGCATGACTATAATGG + Intronic
1034975056 7:155443441-155443463 TTGGTTGTGCTAGCCTAGAACGG - Intergenic
1037810343 8:22082864-22082886 GATGTTGAGCTTGGCTACCAAGG - Intergenic
1041662832 8:60415586-60415608 TGTGTTGTGCTTGCCTCTAGAGG - Intergenic
1049295082 8:141828730-141828752 TATGTAGTTCTACCCTACAAGGG + Intergenic
1051881181 9:21841166-21841188 TATTTTGTGTTTGGCTACCAGGG - Intronic
1052158038 9:25219191-25219213 TCTGTTGCCATTGCCTACAAAGG + Intergenic
1055686163 9:78777247-78777269 TATGTGGTGTCTGCCTTCAAGGG + Intergenic
1058157118 9:101528346-101528368 CCTGTTCTGCTTGCCTACCAAGG + Intronic
1061525792 9:131160955-131160977 TATGGTTTGCTTTCCCACAAGGG + Intronic
1062115472 9:134805937-134805959 TGTGGTGTGCTTGCCTTCAATGG - Intronic
1197164805 X:123365353-123365375 TTTGTTCTCTTTGCCTACAAAGG - Intronic
1200427953 Y:3042372-3042394 TATGTTGTTTTTGCCTGCATTGG + Intergenic