ID: 1126982893

View in Genome Browser
Species Human (GRCh38)
Location 15:54266395-54266417
Sequence CTTCTATTTTAACACGTAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 211}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126982893_1126982896 18 Left 1126982893 15:54266395-54266417 CCCTTTACGTGTTAAAATAGAAG 0: 1
1: 0
2: 0
3: 10
4: 211
Right 1126982896 15:54266436-54266458 GTTAAAATTAAATTTCCTGTTGG 0: 1
1: 0
2: 4
3: 44
4: 452
1126982893_1126982895 -7 Left 1126982893 15:54266395-54266417 CCCTTTACGTGTTAAAATAGAAG 0: 1
1: 0
2: 0
3: 10
4: 211
Right 1126982895 15:54266411-54266433 ATAGAAGACAAGAAATCAATTGG 0: 1
1: 0
2: 0
3: 30
4: 579

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126982893 Original CRISPR CTTCTATTTTAACACGTAAA GGG (reversed) Intronic
903431993 1:23311563-23311585 ATTATATTTTAAAAGGTAAAAGG + Intronic
905089867 1:35421169-35421191 TTTCTTTTTTAACAAATAAAAGG + Exonic
905745490 1:40413750-40413772 CTTTTACTTTAACACCAAAAGGG - Intronic
907652380 1:56307650-56307672 CTTTTATTTGAACACTTAAGAGG - Intergenic
909906750 1:81205978-81206000 TTTTTATTTTAACAAGTAAAAGG + Intergenic
909924332 1:81421167-81421189 CTTCTAAATAAACACGTAATAGG - Intronic
910045892 1:82915483-82915505 CTTAAATTTTAACCAGTAAAGGG + Intergenic
911416612 1:97582934-97582956 CATCTCTTTTAACAAGTAAAGGG + Intronic
912654609 1:111474801-111474823 CTGCTATTGTAACAGGTACAGGG + Intronic
913391332 1:118316016-118316038 CATCTATGTTATCACATAAAGGG - Intergenic
916678207 1:167081970-167081992 CTTCCACTTTAACACTTAATTGG - Intronic
917031540 1:170698534-170698556 AGTCTATTTTAATACGCAAAAGG - Intronic
918368503 1:183835321-183835343 CTTCTATTTTCAGAAATAAAGGG - Intronic
918549959 1:185731027-185731049 GTTCTATTTATACACTTAAAAGG + Intergenic
922017826 1:221669922-221669944 TTTCTATTTTAAAAAATAAAAGG + Intergenic
924917735 1:248591374-248591396 CATCTTTTTTAGCACTTAAAGGG - Intergenic
1062846212 10:707948-707970 ATTCTATTCTAACATGGAAAAGG - Intergenic
1064831820 10:19477159-19477181 CTTATATTTTACCTCATAAAAGG + Intronic
1065517179 10:26535789-26535811 ATTCCATTTTAACAAGTAAGTGG + Intronic
1065739288 10:28782432-28782454 ATTCTATTTTAAAAGGAAAAAGG - Intergenic
1066762981 10:38774276-38774298 TTTCTGTTTTTACACTTAAATGG - Intergenic
1066958594 10:42198155-42198177 TTTCTGTTTTTACACTTAAATGG + Intergenic
1069279987 10:66643631-66643653 CATCTGTTGTAACACATAAAGGG + Intronic
1071076046 10:81754137-81754159 CTCCTAATTTCACACTTAAAAGG - Intergenic
1072096554 10:92187194-92187216 CTTCCATTTTAACACCAAAGGGG + Intronic
1072346479 10:94512845-94512867 CTTCAACTTTAACATGTGAAGGG - Intronic
1073908244 10:108309534-108309556 CTTCTACTTTATCACGTTTATGG - Intergenic
1075314638 10:121442874-121442896 CTTATTTTTTAACACTGAAATGG - Intergenic
1076588293 10:131565764-131565786 CTTCTATTTTAAAATGGAAGTGG + Intergenic
1077658061 11:4041335-4041357 CTTCTACTCTAGCAGGTAAAGGG - Intronic
1083244634 11:61416803-61416825 CTTCTATTTTTAAATGTAGAAGG + Intronic
1083390075 11:62342483-62342505 CTTCACTTTTTACACATAAATGG + Intronic
1084692901 11:70737257-70737279 TTTCTATTTTAACATTGAAACGG - Intronic
1086154525 11:83650859-83650881 CTTCTATTCAAACAGGGAAATGG + Intronic
1086720145 11:90110336-90110358 TTTCTCTTTTTACACTTAAATGG - Intergenic
1086803442 11:91207454-91207476 TTTCTATTTTGACACCTAACAGG - Intergenic
1086816916 11:91383373-91383395 CATGTATTTTAACACATAGAGGG - Intergenic
1087934496 11:104016712-104016734 ATGCTACTTTAACACGGAAAGGG + Intronic
1091043101 11:132300810-132300832 CTTGTATTTAAGCACGTAACAGG - Intronic
1093224290 12:16463025-16463047 CTTCTAATCTAAAACTTAAAGGG + Intronic
1093603881 12:21065728-21065750 CTTGTATTTTACCAGGGAAAGGG - Intronic
1094437634 12:30438865-30438887 CTTTTATTTTAGCAGCTAAAAGG - Intergenic
1095220308 12:39605299-39605321 CTTCTATTTTAAATAGAAAAAGG - Intronic
1098685645 12:73416516-73416538 CTTCTATTTTTAAACTTAATTGG - Intergenic
1101011364 12:100453741-100453763 CTTATATTTTCACACCCAAATGG - Intergenic
1102205064 12:111084709-111084731 CTTCTATTTTAAAAGCAAAATGG + Intronic
1104137395 12:125953612-125953634 CTGCTATTTTAACACGTCCTTGG + Intergenic
1107466178 13:40652674-40652696 GTTCTATTTTGACATGAAAAAGG - Intronic
1109778006 13:67068587-67068609 TTTCTGTTTCAACAGGTAAATGG + Intronic
1110396419 13:75034582-75034604 CTTAAATTTAAACACTTAAAAGG - Intergenic
1110921024 13:81085599-81085621 CTTTTTTTTTCACATGTAAATGG + Intergenic
1114856853 14:26457698-26457720 TTTCTTTTTTAATAAGTAAATGG - Intronic
1115354671 14:32434700-32434722 CTTGGATCTTAACACTTAAATGG + Intronic
1115598733 14:34935000-34935022 CTTCTATTTTTACAAGTCATAGG - Intergenic
1116944862 14:50827245-50827267 CTCCTATATAAACTCGTAAATGG - Intronic
1118527030 14:66656894-66656916 CTTTCACTTTAACACTTAAAGGG - Intronic
1120537658 14:85716437-85716459 CTATTATTTTAACATGGAAAAGG + Intergenic
1123969810 15:25496779-25496801 CTTCTAGTATAACACTGAAAAGG - Intergenic
1124811807 15:32946676-32946698 TTTCTGTTTTAAAACTTAAAGGG - Intronic
1126908273 15:53390494-53390516 CTTCTATTTTTACATTAAAAGGG - Intergenic
1126982893 15:54266395-54266417 CTTCTATTTTAACACGTAAAGGG - Intronic
1127002692 15:54528549-54528571 TTTCTATTTTTTCACGTAATAGG + Intronic
1129661796 15:77556810-77556832 CTTCTATTTTTCCACGTCAGCGG - Intergenic
1129817793 15:78570636-78570658 CTCCTATTTTTACTGGTAAAAGG - Intronic
1130328742 15:82903310-82903332 ACTCCATTTTAACAAGTAAAAGG + Intronic
1135137179 16:19893665-19893687 CTTTTATGTTAACATGTAATAGG + Intergenic
1135189000 16:20339113-20339135 TTTCTATTCTCAGACGTAAATGG - Intronic
1136289996 16:29265828-29265850 CTTCTTTTTAACCACATAAAGGG - Intergenic
1138518354 16:57552862-57552884 CTTCTACTTGAACACTTAAGAGG + Intronic
1138866110 16:60822212-60822234 TTTCTATTTTAAAAATTAAATGG - Intergenic
1140647028 16:77043264-77043286 CTTCTATTGTAACACATCAAGGG - Intergenic
1142095879 16:88239305-88239327 CTTCTTTTTAACCACATAAAGGG - Intergenic
1144878617 17:18418674-18418696 CTTCTGTTTTCCCAAGTAAATGG - Intergenic
1144885136 17:18452566-18452588 CTTCTGTTTTCCCAAGTAAATGG + Intergenic
1145147081 17:20491811-20491833 CTTCTGTTTTCCCAAGTAAATGG - Intergenic
1145153618 17:20525713-20525735 CTTCTGTTTTCCCAAGTAAATGG + Intergenic
1145177032 17:20709412-20709434 CTTCTGTTTTCCCAAGTAAATGG + Intergenic
1145177151 17:20710904-20710926 CTTCTGTTTTCCCAAGTAAATGG - Intergenic
1149255346 17:54820301-54820323 CTTGTATTTTAATAGGTCAAAGG - Intergenic
1150082493 17:62252621-62252643 CTTCTGTTTTCCCAAGTAAATGG + Intergenic
1150962504 17:69929909-69929931 TTTCTATCTGAACACTTAAAGGG - Intergenic
1155194832 18:23463866-23463888 GTTCAATTTTAACATGGAAAAGG + Intronic
1155683633 18:28520495-28520517 TTTCTATTTTCCCACCTAAATGG + Intergenic
1156366752 18:36436111-36436133 CTTCCATTTTAGCATATAAAAGG - Intronic
1160482786 18:79257862-79257884 CTTCTCTTTCACCACGTAAAAGG + Intronic
1164014711 19:21243110-21243132 CTTCTATTTTAACACAGCACTGG + Intronic
1164134502 19:22401064-22401086 CTTCTATTTTAACACAGCACTGG + Intronic
1164164310 19:22655712-22655734 CTTCTATTTTAACACAGCACTGG - Intronic
1167836716 19:52078363-52078385 CTTCTATATTATCATGTGAATGG - Intronic
929195266 2:39178240-39178262 CTTCTATTTTAACTATTAAAAGG + Intronic
929316764 2:40488529-40488551 CTTCCCTTTTAACAGTTAAAAGG - Intronic
929678169 2:43959557-43959579 CTTATTTTTTAACACGTCCATGG - Intronic
934464660 2:94249555-94249577 TTTCTGTTTTTACACTTAAATGG - Intergenic
935803598 2:106725160-106725182 CTTCTATTTAAACACATTCATGG - Intergenic
935837755 2:107074061-107074083 CTTCTATTTTCACAGGTGAAGGG + Intergenic
936855788 2:116955687-116955709 CTTCTCTTTGAACACCTATAGGG - Intergenic
936948927 2:117957587-117957609 CCCCTATTTAAACACGTCAATGG + Intronic
940287902 2:152050515-152050537 CTGCTTTTTTAACAAGCAAATGG + Intronic
941234835 2:162958540-162958562 CTTTTATTTTAAAAGGAAAAAGG - Intergenic
941588028 2:167384095-167384117 CTACTATTTTAAAACTAAAATGG - Intergenic
941592199 2:167433758-167433780 ATTCTATTAAAACACGTAATAGG + Intergenic
941730821 2:168915116-168915138 CATCAATTTTATCACGTGAAAGG + Intergenic
941907108 2:170727321-170727343 CTTATATTTTGACAGGGAAAGGG - Intergenic
944125113 2:196283691-196283713 CTTGTATGTTAAAACGTATATGG + Intronic
944261143 2:197678669-197678691 CTGCTATTTTAACAATTACATGG + Intergenic
944326391 2:198409991-198410013 CATATATTTTAAGAAGTAAAGGG - Intronic
945557198 2:211293230-211293252 TTTATAGTTTAACATGTAAATGG + Intergenic
945892579 2:215445301-215445323 CTTCTATTTTTACAGCGAAATGG + Intergenic
946387503 2:219393741-219393763 CTTCTATTTTCACAGTAAAATGG - Intronic
946803013 2:223441539-223441561 ATTCTATTTTAACACTTTTATGG - Intergenic
947559499 2:231135156-231135178 CTTCTATTTTCACTCCTATAAGG - Intronic
1170403667 20:16013641-16013663 CTTCCATTTTAGTAAGTAAATGG + Intronic
1171817227 20:29797565-29797587 CTTCTATTTTAATATTTCAAAGG - Intergenic
1174022332 20:47541078-47541100 CTTCTATTGTATCAAGTAGATGG + Intronic
1176595706 21:8692729-8692751 TTTCTGTTTTTACACTTAAATGG - Intergenic
1180278566 22:10669842-10669864 TTTCTATTTTTACACTTAAATGG - Intergenic
1180320558 22:11316331-11316353 CTTCTATTTTAATATTTCAAAGG - Intergenic
949228596 3:1723686-1723708 CTTCTATTTAAATAGATAAAAGG + Intergenic
951721793 3:25707344-25707366 CTGCTTTTTTAACTCGAAAAAGG - Intergenic
957084388 3:75666677-75666699 CTTCTCTTTTAATTCGGAAAAGG + Exonic
957863566 3:85991802-85991824 AATATATTTTAACACGAAAATGG - Intronic
960232025 3:115239520-115239542 CTTCTATTTAAAAACAGAAAAGG - Intergenic
962100590 3:132338220-132338242 CTTCTTTTGTTACACGAAAATGG + Intronic
962183788 3:133236723-133236745 CTTCTAGTTTAAGAAGTAACTGG - Intronic
963871732 3:150423076-150423098 GTTCCATTTGAACACGTTAAAGG + Exonic
963971321 3:151432375-151432397 ATTCTACTTTAACACATAATTGG - Intronic
965709357 3:171541622-171541644 CTTGTTTCTTGACACGTAAAGGG + Intergenic
966680795 3:182639838-182639860 ATTATATTTTAACACTTTAAAGG - Intergenic
968394633 4:223549-223571 CTTCTATCTTAACATGTTACTGG - Intergenic
968406977 4:349485-349507 CTTCTATCTTAACATGTGACTGG - Intronic
969998311 4:11337872-11337894 CTTCTATTTTAAGGCTAAAATGG - Intergenic
970409956 4:15795379-15795401 CTTCTATTTAAAGACCAAAAAGG + Intronic
971735878 4:30451441-30451463 CTTATCTTTTAACACTGAAAAGG - Intergenic
972811090 4:42586760-42586782 CTTTTATTTTCACAAGCAAATGG - Intronic
974525943 4:63050197-63050219 TTTCCATTCTAACAAGTAAAGGG - Intergenic
975058543 4:69967393-69967415 CTTCAAATTTACCACGTACAAGG - Intergenic
976330040 4:83820789-83820811 CTTGTATTTTAACACTTGCATGG - Intergenic
977045957 4:92069958-92069980 TTTCTATTTTACCACATAACTGG - Intergenic
977173997 4:93797242-93797264 CATCTATTTTGACATGTAAGTGG - Intergenic
978717030 4:111856960-111856982 TTTCTATTTTAAAAAGTCAATGG - Intergenic
979090150 4:116472980-116473002 TTTCAAATTTAACATGTAAATGG - Intergenic
981174044 4:141659537-141659559 CTTCTTTTTTAACCCCTCAATGG - Intronic
981887362 4:149692530-149692552 CTTTTAGTTTAGCACTTAAAAGG - Intergenic
983093123 4:163529496-163529518 CATTTATTTTAAAATGTAAAAGG + Intronic
984161626 4:176259753-176259775 CTTCTATTTAAAAACATGAATGG + Intronic
985235382 4:187867581-187867603 ATTCTATTTTTAGACGTAAAAGG - Intergenic
987388872 5:17356680-17356702 TTTCTTTTTTAAAATGTAAAGGG + Intergenic
989396138 5:40959069-40959091 CTTCCATTTTAACAGATAAGGGG - Intronic
989652249 5:43704984-43705006 CTACTATTTTAATACATTAAAGG + Exonic
991678504 5:69113538-69113560 CTTATAATTTAACAATTAAAAGG + Intronic
992938001 5:81730789-81730811 CTTCAATTTCATCACTTAAAAGG - Intronic
995800339 5:115987185-115987207 CTTCCACTTTAGCAAGTAAAAGG - Intronic
996331438 5:122333853-122333875 TTACCATGTTAACACGTAAAAGG - Intronic
996949990 5:129114302-129114324 CTTCTTTTTTGACACACAAATGG - Intergenic
996973767 5:129405718-129405740 CTTCTATCTTAACATTTAATTGG - Intergenic
1000595221 5:163207871-163207893 CTTCTGTTTAAACAAGTGAAAGG - Intergenic
1004490884 6:16114465-16114487 CTTTTATTTTAACATGGCAAAGG + Intergenic
1008201350 6:48594360-48594382 CTTTTATTTTAACACATTAAGGG + Intergenic
1008741214 6:54610729-54610751 CTTTTTGTTTAATACGTAAAAGG + Intergenic
1009323371 6:62318524-62318546 CATCTATTTTAGCACCTACAAGG - Intergenic
1010027690 6:71238866-71238888 CTTTTATTTTAACATTAAAATGG + Intergenic
1010178912 6:73062023-73062045 ATTTTATTTTAAGAGGTAAATGG + Intronic
1010328883 6:74598122-74598144 TTTCTATTTTAATAAGAAAATGG + Intergenic
1011939299 6:92823364-92823386 CTTGTATTTTAAAATGGAAAAGG + Intergenic
1014620487 6:123661115-123661137 CTCCTGTTTTCACACCTAAATGG - Intergenic
1014624891 6:123713443-123713465 CCTCTTTTATAACAGGTAAAGGG - Intergenic
1015685528 6:135855221-135855243 CTTCTACATTTACATGTAAATGG - Intronic
1016597678 6:145819834-145819856 CTTCTAATTTACCCCATAAATGG + Intergenic
1017734876 6:157353596-157353618 TATCTATTTTAAAACTTAAATGG - Intergenic
1021400434 7:20203984-20204006 CTTCTATTTTAAAATGCAAATGG - Intronic
1021610038 7:22448188-22448210 CAACTATTTTAACACGGGAAGGG - Intronic
1021908155 7:25356531-25356553 ATACTATTTTAACATGTAATGGG - Intergenic
1022145652 7:27537202-27537224 ATTCAATTTTAAAATGTAAATGG + Intronic
1024320987 7:48069375-48069397 CTACTATTTTATCATCTAAATGG - Intergenic
1026721723 7:72837562-72837584 TTAGTATTTAAACACGTAAATGG + Intergenic
1028433024 7:90769978-90770000 ATTCTTTTTTCTCACGTAAAAGG + Intronic
1028438916 7:90836587-90836609 ATTTTTTTTTAACAAGTAAAAGG + Intronic
1028776483 7:94683213-94683235 CACCTATTTTAACAGGTACATGG + Intergenic
1032273178 7:130430260-130430282 CTGCTATTTTAACATCTAAGGGG + Intronic
1033926107 7:146462427-146462449 CTTCTAACTTCACACATAAAGGG + Intronic
1036132099 8:6125131-6125153 CTTTTATATTAACATGTAATGGG + Intergenic
1037089208 8:14892802-14892824 CTTCTATTTTAAGAGTGAAATGG - Intronic
1037796447 8:21999431-21999453 CTTCTGTTTTCCCACCTAAAAGG + Intronic
1038319045 8:26512051-26512073 CTTGTATTTTCTCACATAAAGGG + Intronic
1039362658 8:36896660-36896682 CTTCTATTTGATCACCTCAAAGG - Intronic
1040544816 8:48390691-48390713 CCTCTTTTTAAACAAGTAAAAGG + Intergenic
1041931592 8:63293331-63293353 TTTCTATATTAACACATAAGTGG - Intergenic
1042815315 8:72872145-72872167 TCTCTATTTTAACAAGCAAATGG - Intronic
1043580866 8:81712692-81712714 CTTCTATAATTACACATAAAAGG + Intronic
1044846293 8:96385145-96385167 CTTCTCTTTTAACCTGTAAGTGG + Intergenic
1045075026 8:98555915-98555937 TTTATATTTTAACAGATAAAAGG + Intronic
1046335168 8:112776584-112776606 CTTCTATTTTCAGATCTAAAAGG + Intronic
1046891850 8:119430700-119430722 CATCTATATTAACACTTATAGGG + Intergenic
1051140568 9:13974708-13974730 CTTCTATTTTGACAGGAAGAAGG - Intergenic
1051852990 9:21530577-21530599 CTTCTACTTGAACACTTAAGAGG + Intergenic
1051965243 9:22820004-22820026 ATTCTATTTTAACCCCAAAATGG - Intergenic
1053694749 9:40626319-40626341 TTTCTGTTTTTACACTTAAATGG - Intergenic
1053941734 9:43256695-43256717 TTTCTGTTTTTACACTTAAATGG - Intergenic
1054270091 9:63013797-63013819 TTTCTGTTTTTACACTTAAATGG + Intergenic
1054305993 9:63425543-63425565 TTTCTGTTTTTACACTTAAATGG - Intergenic
1054404736 9:64749525-64749547 TTTCTGTTTTTACACTTAAATGG - Intergenic
1054438360 9:65235017-65235039 TTTCTGTTTTTACACTTAAATGG - Intergenic
1054492044 9:65786931-65786953 TTTCTGTTTTTACACTTAAATGG + Intergenic
1059009216 9:110438510-110438532 ATGCTATTTTAACACATGAATGG + Intronic
1059984345 9:119807567-119807589 CTTCTATTTTACCAAATAATAGG + Intergenic
1062113355 9:134794925-134794947 CTCCTATTAAAACACGGAAAAGG + Intronic
1203368775 Un_KI270442v1:282078-282100 CTTCTATTTTAATATTTCAAAGG - Intergenic
1185953504 X:4462862-4462884 CTTAAATGTTAACACATAAAAGG - Intergenic
1186114509 X:6291495-6291517 TTTCTATATTAACATGCAAAGGG - Intergenic
1188649038 X:32607628-32607650 CTTATATTTTAACACGGGATTGG + Intronic
1188818965 X:34749815-34749837 CTTCCCTTTTCACATGTAAAAGG + Intergenic
1188998093 X:36910634-36910656 CTTCCCTTTTCACATGTAAAAGG - Intergenic
1191056688 X:56249117-56249139 TTTCTCTTTTAACAGGTTAATGG - Intronic
1191802498 X:65096803-65096825 TTTTTATATTAACATGTAAAGGG + Intergenic
1193617802 X:83711400-83711422 CTGTTATTTTAACAAGGAAAAGG + Intergenic
1194789953 X:98135621-98135643 CTGATATTTAATCACGTAAATGG + Intergenic
1195509852 X:105702450-105702472 CTTCTATTTTACCTCGTGTAGGG - Intronic
1197822197 X:130552733-130552755 CTTCTATTTCAAAAGGTTAAAGG - Intergenic
1200983696 Y:9285220-9285242 TTTCTTTTTTAACTCATAAAAGG + Intergenic
1201069802 Y:10136400-10136422 CTTCTATTTTAATATTTCAAAGG + Intergenic
1201192554 Y:11458267-11458289 TTTCTGTTTTTACACTTAAATGG - Intergenic
1202126670 Y:21574482-21574504 TTTCTCTTTTAACTCATAAAAGG - Intergenic