ID: 1126990273

View in Genome Browser
Species Human (GRCh38)
Location 15:54366893-54366915
Sequence GTATCCTGCTGTGCTGTAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 82}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126990273_1126990275 4 Left 1126990273 15:54366893-54366915 CCTGTTACAGCACAGCAGGATAC 0: 1
1: 0
2: 0
3: 9
4: 82
Right 1126990275 15:54366920-54366942 CCTTAAGAGCCAGTTAGACCAGG 0: 1
1: 0
2: 1
3: 7
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126990273 Original CRISPR GTATCCTGCTGTGCTGTAAC AGG (reversed) Intronic
900335615 1:2161533-2161555 GTTTCCTGATGTGGTGTCACAGG + Intronic
906689806 1:47785051-47785073 TGATCCTGCTGTGCTCTACCAGG - Intronic
915117308 1:153608917-153608939 GACTCCAGCTGGGCTGTAACTGG - Intronic
924093190 1:240523332-240523354 GGATCATTCTGTGCTGTAAGGGG + Intronic
1064766141 10:18674107-18674129 CAATCCTGCTGTGCTCTCACAGG + Exonic
1067145729 10:43692457-43692479 GTCTCCTGCTGTGCTGCACATGG + Intergenic
1069834259 10:71298868-71298890 GGATCTTGCTGAGCGGTAACTGG + Intronic
1071512041 10:86268116-86268138 GTGTCTTTCTGTGCTGAAACTGG - Intronic
1078287576 11:9973063-9973085 GTATACTGCTGCCCTCTAACGGG + Intronic
1078448735 11:11424676-11424698 TTATCCTGCTGTGTTTTACCTGG - Intronic
1079567713 11:21903099-21903121 GCATCCTGCTGAGCTGGTACAGG - Intergenic
1079960053 11:26912949-26912971 GTACACTGGTGTGCTGTAACTGG - Intergenic
1082938224 11:58676219-58676241 TCTTCCTGCTGTGCTGTTACAGG + Intronic
1089920254 11:122203034-122203056 TTCTCCTCCTGTCCTGTAACTGG - Intergenic
1091075055 11:132607507-132607529 GTATCCTTGTGTTCTGGAACTGG + Intronic
1092135063 12:6141388-6141410 GAATCCTGCTGTGCTACTACTGG - Intergenic
1097373587 12:58814367-58814389 GTATCGAGCTGTGCAGTGACAGG - Intergenic
1098241773 12:68474592-68474614 GGATCCTGCTTTGCTGCATCCGG + Intergenic
1099150008 12:79098702-79098724 GTACCCTGCTGTGGTACAACAGG + Intronic
1108141876 13:47432069-47432091 GCCTCCTGCTGTGATGCAACAGG + Intergenic
1112073128 13:95876620-95876642 CTCTCCAGCTGTGCTGTATCAGG + Intronic
1113764030 13:112869735-112869757 GGAGGCTGCTGTGCTGTAACTGG - Intronic
1119034197 14:71215917-71215939 GAAACCTGCTGTGCTTAAACCGG + Intergenic
1119083865 14:71722019-71722041 GTGTTGTGCTCTGCTGTAACAGG + Intronic
1119295042 14:73526180-73526202 GTGTAGTGCTGTGCTGTGACAGG - Intronic
1124126785 15:26944235-26944257 GCCTCCTGCTCTGCTGTAACTGG - Intronic
1126518983 15:49567828-49567850 GTATTGTGCTTTACTGTAACAGG + Intronic
1126990273 15:54366893-54366915 GTATCCTGCTGTGCTGTAACAGG - Intronic
1131248220 15:90814261-90814283 CTTTCCTGCTGCTCTGTAACCGG - Intronic
1132725870 16:1338166-1338188 GCCTCCTGCTGTGCTGTCGCGGG + Intronic
1134156107 16:11844603-11844625 GTACCCTGCTCTGCTCTACCTGG + Intronic
1140272657 16:73480624-73480646 GCATCCTGCTGTGGGGAAACAGG - Intergenic
1141522497 16:84590352-84590374 GTCTCCTGCTGTGCTGCTCCAGG - Intronic
1142058264 16:88014110-88014132 GTCTCCTGCGGTGCTGAAAAAGG + Intronic
1142319501 16:89371922-89371944 GCAGCCTCCTGTTCTGTAACAGG - Intronic
1150361128 17:64535090-64535112 GTGTCCAGCTGTGCTGTGAGGGG + Intronic
1150781361 17:68125261-68125283 TTACCCTGCAGTGCTTTAACTGG + Intergenic
1153368142 18:4282777-4282799 GCATGCTGCTGTGTCGTAACTGG - Intronic
1155126159 18:22878209-22878231 GTCTCCTGGTGTGATGTAATAGG + Intronic
1160668803 19:346245-346267 GTGAGGTGCTGTGCTGTAACAGG + Intergenic
1160941664 19:1622937-1622959 GTCTGCTGCTGTGCTGGAGCGGG + Intronic
1162786131 19:13036134-13036156 GTATCCTGCTTGGCTGCACCTGG + Intronic
1168082646 19:54021504-54021526 TTCTCCTGCTGTGCTCTAGCCGG + Intergenic
929920483 2:46167904-46167926 GGAGCCTGCTGTGCTGGAACAGG - Intronic
930858857 2:56049005-56049027 GTATCCAGCTGTGAAGTAGCTGG + Intergenic
935998822 2:108803836-108803858 TTATCCTGCTGTGCTAGAAATGG + Intronic
937265181 2:120610851-120610873 GCATCCAGCTGTCCTGTAATTGG + Intergenic
938692759 2:133807543-133807565 GTTTTCTGCTGTGCTGCAGCTGG - Intergenic
941321046 2:164055046-164055068 ATATCCTGCTATACTGTAGCAGG + Intergenic
944000006 2:194822378-194822400 TTAACCTACTGTGGTGTAACTGG + Intergenic
1170888312 20:20358414-20358436 GTATGCTGCTGTTCTGACACTGG - Intronic
1172991273 20:39038754-39038776 GCATCCTTCTGTGCTGCAGCGGG + Exonic
1175716292 20:61256268-61256290 ATGTCCTGCTGTGCTGAAACTGG + Intronic
1177771264 21:25519015-25519037 CTATCCTACTGTGGTGGAACTGG - Intergenic
1179265211 21:39796995-39797017 GCATCCTCCTCTGCTGAAACTGG + Intronic
1181812024 22:25409157-25409179 GTGTCCTGATGAGCTGTGACAGG - Intergenic
1182770417 22:32791653-32791675 GTATGCTGCCGTGCTGGAATTGG - Intronic
953083861 3:39647760-39647782 GGACCCAGCTGAGCTGTAACTGG - Intergenic
955836249 3:63058609-63058631 GTATCCTGCTGTGCACTGGCTGG + Intergenic
957968806 3:87356587-87356609 ATATCCTGCTATTCTGTAATGGG + Intergenic
959575516 3:107928593-107928615 GCATGCTGCTGTGCTGTATCAGG - Intergenic
961174806 3:124825920-124825942 ATATCCTACTGTGCTGGAAAAGG + Intronic
963679337 3:148353777-148353799 ATATACTTCTGTGTTGTAACTGG - Intergenic
967708641 3:192680584-192680606 GTTTCCTGCTGTGCAATCACTGG - Intronic
968218383 3:196914211-196914233 ATCTGCTTCTGTGCTGTAACAGG - Intronic
971172214 4:24245120-24245142 GCAGCCTGTTGTGCTGTCACTGG - Intergenic
973735557 4:53868284-53868306 GTTTCCTGTTGTGCAGTATCTGG + Intronic
975243887 4:72095235-72095257 GTCTGCTGGTGTGCTGGAACTGG + Intronic
977716724 4:100190959-100190981 GTATCCTCCTCTGCTGCAAGCGG + Intergenic
978228288 4:106365506-106365528 CTATCTTTCTGGGCTGTAACAGG + Intergenic
986649096 5:9946382-9946404 GAATCCTGCAGTGCTGTCAGAGG + Intergenic
992961799 5:81963068-81963090 GTATCCTATTGTTCTGTAAAGGG - Intergenic
995555429 5:113323318-113323340 GTAATTTGCTGTGCTGTAATAGG + Intronic
1002374919 5:178781892-178781914 GTCTCCTGCTGTGCTGTGCCTGG - Intergenic
1008243492 6:49142572-49142594 GTACCCTGCTGTTCTCCAACAGG + Intergenic
1011133724 6:84077099-84077121 ATATACTGATGTGCTGTAATTGG - Intronic
1015870078 6:137767426-137767448 GTGTCCTCCTCTGCTGTACCAGG + Intergenic
1018027657 6:159818459-159818481 GTGTCCTTCTGTTCTGTCACCGG + Intronic
1022515378 7:30971893-30971915 GGATTCTGGTGTGCTGCAACTGG - Intronic
1037948258 8:23002964-23002986 CATTCCTGCTGGGCTGTAACTGG - Intronic
1039622230 8:39008784-39008806 GAAACCTACTGTGCTGTAAATGG + Intronic
1040497536 8:47979899-47979921 GTATCCTTCAGTGCAGTACCTGG + Intergenic
1043340309 8:79229839-79229861 CTATCCTGCTGTGGTTGAACTGG + Intergenic
1050406559 9:5314620-5314642 GTACCCTGCTTTCCTGGAACTGG + Intergenic
1051386008 9:16509554-16509576 CTATCCTGGTTTTCTGTAACTGG - Intronic
1055494395 9:76840380-76840402 GCATGCTGGTGTGCTGTAAATGG - Intronic
1060958636 9:127663330-127663352 GTACCCGGCTGTGCGGTATCGGG + Exonic
1061520560 9:131115029-131115051 GCATCCTGCTGTGCAGCTACTGG + Intronic
1188771260 X:34157528-34157550 GTATCCTGCTGCACTGTCACTGG - Intergenic
1188932099 X:36124130-36124152 TTATCCTGCTGTGCCTGAACTGG + Intronic
1189739020 X:44099872-44099894 TTACCTTGCTGTGCTATAACTGG - Intergenic
1197525350 X:127555449-127555471 GTATCCTGCTGTGCTGAGATTGG + Intergenic