ID: 1126990891

View in Genome Browser
Species Human (GRCh38)
Location 15:54374386-54374408
Sequence CATGAGAGGGAGGCCGGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 720
Summary {0: 1, 1: 1, 2: 4, 3: 64, 4: 650}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126990891_1126990907 10 Left 1126990891 15:54374386-54374408 CCCACCCCGGCCTCCCTCTCATG 0: 1
1: 1
2: 4
3: 64
4: 650
Right 1126990907 15:54374419-54374441 CCCAAAGTCTGGAGGGGCCAAGG 0: 2
1: 1
2: 10
3: 45
4: 303
1126990891_1126990909 17 Left 1126990891 15:54374386-54374408 CCCACCCCGGCCTCCCTCTCATG 0: 1
1: 1
2: 4
3: 64
4: 650
Right 1126990909 15:54374426-54374448 TCTGGAGGGGCCAAGGCAGCAGG 0: 2
1: 0
2: 9
3: 89
4: 1040
1126990891_1126990899 -1 Left 1126990891 15:54374386-54374408 CCCACCCCGGCCTCCCTCTCATG 0: 1
1: 1
2: 4
3: 64
4: 650
Right 1126990899 15:54374408-54374430 GCCCCTCAGCACCCAAAGTCTGG 0: 1
1: 0
2: 13
3: 52
4: 228
1126990891_1126990911 24 Left 1126990891 15:54374386-54374408 CCCACCCCGGCCTCCCTCTCATG 0: 1
1: 1
2: 4
3: 64
4: 650
Right 1126990911 15:54374433-54374455 GGGCCAAGGCAGCAGGGAGCTGG 0: 2
1: 18
2: 71
3: 223
4: 991
1126990891_1126990903 2 Left 1126990891 15:54374386-54374408 CCCACCCCGGCCTCCCTCTCATG 0: 1
1: 1
2: 4
3: 64
4: 650
Right 1126990903 15:54374411-54374433 CCTCAGCACCCAAAGTCTGGAGG 0: 1
1: 7
2: 36
3: 95
4: 311
1126990891_1126990905 4 Left 1126990891 15:54374386-54374408 CCCACCCCGGCCTCCCTCTCATG 0: 1
1: 1
2: 4
3: 64
4: 650
Right 1126990905 15:54374413-54374435 TCAGCACCCAAAGTCTGGAGGGG 0: 14
1: 27
2: 81
3: 155
4: 310
1126990891_1126990904 3 Left 1126990891 15:54374386-54374408 CCCACCCCGGCCTCCCTCTCATG 0: 1
1: 1
2: 4
3: 64
4: 650
Right 1126990904 15:54374412-54374434 CTCAGCACCCAAAGTCTGGAGGG 0: 1
1: 17
2: 35
3: 120
4: 308
1126990891_1126990910 18 Left 1126990891 15:54374386-54374408 CCCACCCCGGCCTCCCTCTCATG 0: 1
1: 1
2: 4
3: 64
4: 650
Right 1126990910 15:54374427-54374449 CTGGAGGGGCCAAGGCAGCAGGG 0: 2
1: 1
2: 9
3: 75
4: 635

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126990891 Original CRISPR CATGAGAGGGAGGCCGGGGT GGG (reversed) Intronic
900106755 1:984792-984814 AATGAAAAGGAGGCCGGGCTTGG - Intergenic
900372409 1:2337814-2337836 TCTGAGAGGGAGGCAGGGGCTGG + Intronic
900431694 1:2605818-2605840 CTGGAGAGGGTGGCGGGGGTGGG + Intronic
900807045 1:4774353-4774375 CATGATAGGCAAGCCGGGGCAGG - Intronic
901003103 1:6158715-6158737 CAAGAGATGGAGGCCGGGCGCGG + Intronic
901123382 1:6912699-6912721 GCTGAGAGGGAGGCAGAGGTGGG - Intronic
901270815 1:7952100-7952122 CATCAGAGGGAGACCGTGGAAGG - Intergenic
902339330 1:15772455-15772477 CATGAGAGGGAGGGGGGAGTGGG + Intronic
902665803 1:17937149-17937171 CAGGAGAGGATGGCAGGGGTTGG - Intergenic
902667348 1:17948831-17948853 CATGACAGGGAGGGAGGGATGGG - Intergenic
902789859 1:18760377-18760399 TCTGAGAGGGAGGCCAGGGGAGG + Intergenic
902864748 1:19270599-19270621 CAGGAAAGGGAGGTCAGGGTGGG + Intergenic
902866966 1:19286036-19286058 CAGGAAAGGGAGGCCAGGGTGGG + Intronic
902870017 1:19308306-19308328 CAGGAAGGGGAGGCCAGGGTGGG + Intronic
903081191 1:20814806-20814828 CATCAGAGGGAGACCGTGGAAGG - Intronic
903832537 1:26183610-26183632 CATGAGTGGGAGGCAGAAGTGGG + Intronic
903954116 1:27013024-27013046 CCTGAGAAGGAGGGCGGGGCAGG - Intergenic
903961943 1:27063469-27063491 CATCAGAGGGAGACCGTGGAGGG - Intergenic
904059691 1:27698888-27698910 CATGGTTGGGAGGCCGAGGTGGG + Intergenic
904784943 1:32975812-32975834 CATCAGAGGGAGACCGTGGAAGG + Intergenic
904877565 1:33668192-33668214 CAGGAGAGGTAGGCAGGGGCAGG + Intronic
905244896 1:36605932-36605954 CAGGAGAGGGAGGCAGAGATGGG + Intergenic
906144003 1:43549411-43549433 CATGAGAGAGGGGCTGGGCTGGG + Intronic
906427034 1:45724005-45724027 CATCAGAGGGAGACCGTGGAAGG - Intronic
906530010 1:46518327-46518349 CATGAGAAGGAGGTGGGGGCAGG + Intergenic
906633070 1:47388828-47388850 AATGAGAGATAGTCCGGGGTAGG + Intergenic
906762081 1:48384308-48384330 CATCAGAGGGAGACCGTGGAGGG + Intronic
908445986 1:64200488-64200510 CATCAGAGGGAGACCGTGGAAGG - Intergenic
909641302 1:77871058-77871080 CATCAGAGGGAGACCGTGGAAGG + Intronic
911090572 1:94013930-94013952 CATGAGTGGGAAACAGGGGTAGG + Intronic
912167474 1:107057508-107057530 CAGGAGCTGGAGGCCGGAGTGGG + Exonic
912447896 1:109751596-109751618 CTTGAGTTGGAGGTCGGGGTGGG - Intronic
912547422 1:110460942-110460964 ATCCAGAGGGAGGCCGGGGTGGG + Intergenic
912751529 1:112292605-112292627 CATCAGAGGGAGACCGTGGAAGG - Intergenic
912927071 1:113922621-113922643 CAGGACTGGGAGGCCGAGGTAGG - Intergenic
912927096 1:113922826-113922848 CTTGAGAGGGAGGCTGAGGTTGG - Intergenic
913255241 1:116947264-116947286 CATGACAGGGAGGAGGGGCTGGG - Intronic
913614825 1:120547771-120547793 TACGTGAGGGAGGCCGAGGTGGG + Intergenic
914887840 1:151599612-151599634 CATCAGAGGGAGACCGTGGAAGG - Intergenic
914916462 1:151822294-151822316 CAGGAGCGGGAGGGCTGGGTGGG + Intronic
915474233 1:156143589-156143611 TAAGAGAGGGAGGCTGAGGTGGG + Intergenic
917376264 1:174351052-174351074 CATGAGAGGGAGACCGTGGGGGG + Intronic
917421535 1:174868798-174868820 CTTGATAGGGAGGCCTGGGTGGG - Intronic
917848860 1:179043150-179043172 CATGGGAGGGAGGCCAAGGGAGG - Intronic
917959114 1:180128490-180128512 CATGGGAGGGAGCCCGGGCCAGG + Intergenic
918548965 1:185717858-185717880 AATTAGAGGGAGGCTTGGGTAGG + Intergenic
919142949 1:193596158-193596180 TAAGAGAGGGAGGCCGGGCATGG + Intergenic
919420630 1:197365737-197365759 CAAGAGAAGGTGGCCGAGGTTGG - Intronic
919735590 1:200948249-200948271 CAGAAGAGGGGGGCCGGGGTGGG + Intergenic
919977020 1:202619357-202619379 CCGGAGAGGGAGGCTGGGGGTGG + Intronic
920118218 1:203636325-203636347 CAGGATGGGGAGGCGGGGGTGGG - Intronic
921097759 1:211901725-211901747 CATGGGAGGGAAGCCTAGGTGGG + Intergenic
921216233 1:212939002-212939024 GATGGGAGGGAGGCCGGGCGCGG - Intergenic
921291784 1:213664186-213664208 AATGAGCGGGGGGGCGGGGTGGG + Intergenic
921498506 1:215870539-215870561 CAGCAGTGGGAGGCCGAGGTGGG - Intronic
921706023 1:218323710-218323732 CATGAGAGGGAGGCCGAGGTGGG - Intronic
922436781 1:225615004-225615026 CATCAGAGGGAGACCGTGGAGGG - Intronic
923049227 1:230379064-230379086 CATGTGAGTGAGGCCATGGTTGG - Intronic
923070214 1:230557358-230557380 GATGGGAGGGAGGTCAGGGTGGG + Intergenic
923622206 1:235588273-235588295 CCTGAGAGGGAGGCCATGGAGGG - Intronic
923666089 1:235999858-235999880 CATGAGAGGAAGGGGAGGGTTGG + Intronic
924693390 1:246374724-246374746 CAGGAGTGTGAGGCCGAGGTTGG + Intronic
1062873903 10:931013-931035 CAGGGTCGGGAGGCCGGGGTTGG - Intronic
1063084831 10:2806952-2806974 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1063365708 10:5488998-5489020 CGTGAGAGGGAAGCCAGGGGAGG + Intergenic
1063466465 10:6248380-6248402 TTTGGGAGGGAGGCCGAGGTGGG + Intergenic
1063576310 10:7265174-7265196 GAAGAGAGGGAGGCAGGGGAGGG - Intronic
1063608941 10:7546815-7546837 CTGGAGAGGGAGGCCAGCGTGGG + Intergenic
1064108823 10:12520901-12520923 CATCAGAGGGAGACCGTGGAAGG + Intronic
1065286623 10:24193163-24193185 CAGGAGGGGGAGGCCGAGGTGGG - Intronic
1065293218 10:24251643-24251665 CATGTAAGGGAGGCAGGTGTGGG - Intronic
1065600131 10:27359458-27359480 CCTGAGAGGGAGGCCAAGGCGGG + Intergenic
1065975206 10:30835816-30835838 CAGGAAAGTGAGGCCGGGGGAGG + Intronic
1068969434 10:62947048-62947070 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1069403627 10:68075313-68075335 CACGCGAGGGAGGCGGGGGAGGG + Intronic
1069561824 10:69436051-69436073 CCTGGGAGGGAGGCTGAGGTGGG - Intergenic
1069741622 10:70688829-70688851 CATGAGAGGGAGACCGGAGGGGG + Intronic
1069751553 10:70748432-70748454 CCTGAGGGAGAGGCCTGGGTGGG + Intronic
1069798795 10:71069750-71069772 GATGGGAGGGAGGGCGGGTTAGG - Intergenic
1069801538 10:71084837-71084859 CATGGGTGGGAGGCCTGGGGTGG - Intergenic
1069937312 10:71926548-71926570 GAAGAGAGGGAGGCATGGGTGGG - Intergenic
1070201227 10:74207951-74207973 CATGGGAAGGAGGCCAAGGTGGG - Intronic
1070548288 10:77470042-77470064 GGTGAGAAGGAGGCCAGGGTCGG + Intronic
1070640364 10:78164459-78164481 CAGGACAGGGAGGATGGGGTAGG + Intergenic
1070779115 10:79127299-79127321 CATGAGAGAGAGGCCGCTGCAGG - Intronic
1070811800 10:79301809-79301831 CATGATGGGGAGGCAGTGGTAGG + Intronic
1071533595 10:86408561-86408583 GTAGAGAGGGAGGCAGGGGTTGG + Intergenic
1072602565 10:96942415-96942437 CATCAGAGGGAGACCGTGGAAGG + Intronic
1072712377 10:97724408-97724430 CACGAGAGGGAGGAGGGGCTGGG - Intergenic
1072731641 10:97850388-97850410 CAGGAGTGGGAGGCGGGAGTTGG + Intronic
1074308253 10:112298745-112298767 CGTGAGAGGAAGGCCTGGGCAGG + Intronic
1074908438 10:117885293-117885315 CAGGAGAGGGAGGCTGCTGTGGG - Intergenic
1075075755 10:119349192-119349214 CATGGGAGGGAGGCAGGGAGGGG + Intronic
1075370710 10:121932609-121932631 CAGGATTGGGAGGCCGAGGTGGG - Intergenic
1076073928 10:127517041-127517063 CATGAGAGGGGGGCTGGTGGAGG + Intergenic
1076830304 10:132991211-132991233 CATGACAGGGAGCCTGGTGTGGG - Intergenic
1077061840 11:620986-621008 CAGGAGAGGAAGGGCGGGGTCGG - Intronic
1077131213 11:973683-973705 CAGGAGAGGGAGGGTGGGGCTGG + Intronic
1077152224 11:1077522-1077544 CATGAGGGTGAGGCCGGCGCGGG - Intergenic
1077322591 11:1948964-1948986 GATGAGAGGCTGGCAGGGGTTGG - Intronic
1077514491 11:2993133-2993155 CATGAGAGGGAGAACAGGGCGGG - Intergenic
1077558054 11:3236079-3236101 CAAGAGAGGGAGGCTGAGGTGGG + Intergenic
1077874670 11:6294098-6294120 CAAGAGAAGGAGGCAGGGGCAGG + Intergenic
1078176713 11:8977391-8977413 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1079702050 11:23560241-23560263 AATGAGAGTGAGGGCAGGGTAGG - Intergenic
1079750685 11:24192325-24192347 CATGAGAGGGACTCCGTGGGAGG - Intergenic
1081718838 11:45271502-45271524 CTGGAGAGGAAGGCTGGGGTTGG + Intronic
1081751040 11:45511575-45511597 ACTGAGAGGGAGGCCAGTGTGGG - Intergenic
1081767439 11:45621411-45621433 CATGGGAGGGAGGCTGAGGTGGG - Intergenic
1082687748 11:56260614-56260636 CATGGGAGGGAGGCTGTGGGGGG - Intergenic
1082871168 11:57944618-57944640 CATCAGAGGGAGACCGGGGAGGG + Intergenic
1083234032 11:61340648-61340670 CATAAGAGGAAGGCAGGGGCCGG - Intronic
1083303340 11:61750104-61750126 ACTGACAGGGAGGCTGGGGTGGG + Intergenic
1083711122 11:64549204-64549226 GATGAAAGGGAGGCCGAGGCGGG - Intergenic
1083857706 11:65401324-65401346 CAGGGGAGGGAGGCTGGGGAGGG - Intronic
1083857712 11:65401337-65401359 CAGGGGAGGGAGGCAGGGGAGGG - Intronic
1083857718 11:65401350-65401372 CAGGGGAGGGAGGCAGGGGAGGG - Intronic
1083857729 11:65401376-65401398 CAGGGGAGGGAGGCTGGGGAGGG - Intronic
1083916031 11:65744300-65744322 CATGGGAGGGAGGCCAAGGCGGG + Intergenic
1084576306 11:69990145-69990167 TAGGAGAGGCAGGGCGGGGTGGG - Intergenic
1084789198 11:71462886-71462908 CAGGAGAGGGCGGCCTGGCTGGG - Intronic
1085480711 11:76820825-76820847 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1085496827 11:76978041-76978063 CATGGGAGGGAGGCCGAGGCGGG + Intronic
1087046455 11:93847633-93847655 AATGAGAGGGAGCACTGGGTGGG + Intronic
1087124114 11:94606486-94606508 GATGAGAAGGAGGCGGAGGTAGG + Intronic
1087211109 11:95447063-95447085 CATCAGAGGGAGGCCGAGGTGGG - Intergenic
1087487148 11:98770727-98770749 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1088073749 11:105821535-105821557 CAAGAGAGAGAGGGCGGGGGAGG + Intronic
1088367197 11:109052255-109052277 CATGGGAGGGAGTCCAGGGATGG - Intergenic
1088413781 11:109567204-109567226 CATCAGATGGAGGCAGGGTTAGG + Intergenic
1088665934 11:112093723-112093745 GATCAGAGGAAGGCAGGGGTCGG - Intronic
1089280122 11:117368385-117368407 CATGAGAGGCAGGCAGGAGCTGG + Intronic
1089617992 11:119705944-119705966 CCTGAGAGGGAGGCGGGGAGGGG + Intronic
1089682374 11:120125832-120125854 CATGATAGGTGGGCAGGGGTGGG + Exonic
1089737478 11:120559900-120559922 CCTGAGAGGGAGGCCTGAGAGGG + Intronic
1090095659 11:123740305-123740327 CATAAGAGGGTGGGCAGGGTTGG - Intronic
1090203996 11:124875018-124875040 CATGAGTGGGAGGAGGGGCTGGG + Intronic
1090791338 11:130092683-130092705 CATGAGAGGGAGACCGTGGGGGG + Intronic
1090907061 11:131085118-131085140 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1202805608 11_KI270721v1_random:4277-4299 GATGAGAGGCTGGCAGGGGTTGG - Intergenic
1091647975 12:2288229-2288251 CTGGAGAGGGAGGCCAGGGAGGG - Intronic
1092453373 12:8624380-8624402 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1092828026 12:12415522-12415544 CATCAGAGGGAGACCGTGGAAGG + Intronic
1093464912 12:19439645-19439667 CGAGAGAGGGAGGCGGCGGTGGG + Intronic
1093493052 12:19726261-19726283 CATAGGAGGGAAGCCGAGGTGGG - Intergenic
1093525766 12:20102304-20102326 CATGGGAGGGAGGCCAAGCTGGG - Intergenic
1094103084 12:26784374-26784396 CATCAGAGGGAGACCGTGGAAGG - Intronic
1094134148 12:27106315-27106337 CATGTGAGGGAGGTCAAGGTTGG + Intergenic
1096039581 12:48501481-48501503 CATGAGAGGGAGACCGTGGAAGG + Intergenic
1096235803 12:49925669-49925691 CAAGAGAGGAAGGGCTGGGTAGG - Intergenic
1096252914 12:50044790-50044812 TAGGAGATGGAGGCCGGGGCTGG - Intergenic
1096703390 12:53402546-53402568 AATGAGAAGGAGGCCGGGCAAGG + Intronic
1097269719 12:57766564-57766586 CGGGAGGGGGAGGCCGGAGTGGG - Intronic
1098379700 12:69854317-69854339 CATCAGAGGGAGACCGTGGAGGG + Intronic
1098412435 12:70201154-70201176 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1098790528 12:74816740-74816762 CATGGGAGGGAGGCTGAGGTGGG + Intergenic
1098822669 12:75252620-75252642 CAGGAGTGGGAGGCCGAGGCAGG + Intergenic
1099019447 12:77385025-77385047 CAGGAAAGGAGGGCCGGGGTAGG + Intergenic
1099910952 12:88832770-88832792 CATGAGAGAGAGGTGGAGGTGGG + Intergenic
1102508828 12:113400737-113400759 CATGACAGGCTGGCCAGGGTGGG + Intronic
1104254652 12:127125418-127125440 AATGGGAGGCAGGCTGGGGTGGG + Intergenic
1104277336 12:127341720-127341742 CAGGCGAGGGAGGGCAGGGTGGG + Intergenic
1104634589 12:130429773-130429795 CGTGAGAGGGAGGACGGGAAGGG + Intronic
1104742480 12:131188630-131188652 CATGGGAGGGAGGCTGAGGGGGG + Intergenic
1104951381 12:132442130-132442152 GACGAGTGGGTGGCCGGGGTAGG - Intergenic
1104951397 12:132442187-132442209 GAGGAGTGGGTGGCCGGGGTTGG - Intergenic
1105675530 13:22667877-22667899 CGTGAGATGGAAGCAGGGGTAGG - Intergenic
1107001372 13:35549588-35549610 TATGAGAGGAAGGCCAAGGTTGG - Intronic
1108322948 13:49304575-49304597 CAAGACAGGGAGCCCGGGATGGG - Intergenic
1108349551 13:49579331-49579353 AATGAAAGGGAGGCCGGGCGTGG + Intronic
1108868596 13:54952963-54952985 CTTGGGAGGGAGGCTGAGGTGGG + Intergenic
1109762249 13:66845254-66845276 CATGGGAGGGAGGCTGAAGTGGG - Intronic
1109982256 13:69924116-69924138 CATGGGAGGGAGGCCAAGGAGGG + Intronic
1110342892 13:74413708-74413730 CATGGGAGGGAGGCTGAGGCAGG + Intergenic
1110777953 13:79432320-79432342 CATGGGAGGGAGGCCAAGGAGGG + Intergenic
1111237760 13:85431217-85431239 CATGGGAGAGAGGCCACGGTGGG + Intergenic
1111485658 13:88895707-88895729 CATGGGAGGGAGGCCAAGGCAGG + Intergenic
1112178711 13:97054837-97054859 CATGGGAGCGAGGCTGGGGGAGG - Intergenic
1112401935 13:99085826-99085848 AAGGAGAGGGAGGCCGGGGGAGG + Intronic
1112650664 13:101393568-101393590 CATAAGTGGGAGGCCGAGGCGGG + Intronic
1113472504 13:110556978-110557000 CATGAGAGGGCAGCCCGGATTGG + Intronic
1113807702 13:113119109-113119131 CATGGGAGGGAGGGAGAGGTGGG + Exonic
1114082840 14:19216425-19216447 CTTGGGAGGGAGGCTGAGGTGGG + Intergenic
1114198934 14:20505337-20505359 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1115399428 14:32939839-32939861 CAGGAGGAGGAGGCCGGGGGCGG + Intronic
1115703911 14:35978605-35978627 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1115901006 14:38148137-38148159 CATGATGGGAAGGCAGGGGTTGG + Intergenic
1115982761 14:39071941-39071963 AATGTGAGGGAGGCCGGGCGGGG + Intronic
1116840949 14:49820641-49820663 CATGAGAGGGAGACCGTGGAAGG - Intronic
1117269744 14:54130935-54130957 AATGAGTGGGAGGCTGAGGTAGG - Intergenic
1117558515 14:56911227-56911249 CATGGGTGGGGGGCGGGGGTGGG - Intergenic
1117867505 14:60165132-60165154 CCCGAGTGGGAGGCCGGGCTCGG - Intronic
1117989137 14:61416661-61416683 CAGGAGAGAGAAGCAGGGGTGGG - Intronic
1118236274 14:64008190-64008212 CTTGAGAGGGAGGCAGGGAGAGG - Intronic
1118734579 14:68692146-68692168 GATGAGAGGGAGACTGGGGGCGG - Intronic
1119318942 14:73718215-73718237 CTTGGGAGGGAGGCCGCGGCAGG - Exonic
1119377820 14:74208886-74208908 CATGGGAGGGAGCACGTGGTGGG + Intergenic
1119431114 14:74568426-74568448 CATGAGCCGGAGGAAGGGGTGGG + Intronic
1120953685 14:90063259-90063281 AATGGGATGGAGGCGGGGGTAGG + Intronic
1120984914 14:90326202-90326224 AAAGAGAGGGAGGCCGGGCGCGG + Intronic
1121028378 14:90634479-90634501 GAAGAGAGGGAGGCCGGGTGGGG + Intronic
1121615549 14:95311356-95311378 CAGGAGAGGAAAGCAGGGGTGGG + Intronic
1121871065 14:97407950-97407972 AATCAGAGGGAGGCAGAGGTGGG - Intergenic
1122227419 14:100287695-100287717 AATAAGAGGCAGGCCAGGGTGGG - Intergenic
1122386119 14:101349344-101349366 CATGGGAGGGAGGCCAGTGGGGG - Intergenic
1122568707 14:102678175-102678197 CATCAGAGGGAGACCGTGGAAGG + Intronic
1122622093 14:103064987-103065009 CATGCTTGGGAGGCCGAGGTGGG - Intergenic
1122866211 14:104605106-104605128 CAGGAGAGAGAGGGCGGGGCGGG + Intronic
1202900227 14_GL000194v1_random:32231-32253 CAGCAGAGGAAGACCGGGGTAGG + Intergenic
1125799112 15:42429009-42429031 CATGTAAGGGAGGCCGAGGCGGG - Intronic
1126115871 15:45207098-45207120 GAGGGGAGGGAGGCCGGGGAGGG + Intergenic
1126295205 15:47131773-47131795 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1126924726 15:53571374-53571396 CAGGAGCTGGAGGCAGGGGTTGG - Intronic
1126990891 15:54374386-54374408 CATGAGAGGGAGGCCGGGGTGGG - Intronic
1127305372 15:57700476-57700498 CGTGGGAGGGAGGCTGAGGTGGG + Intronic
1127433311 15:58933267-58933289 CATGGTAGGGAGGCCAGGGGCGG - Intronic
1127498311 15:59533007-59533029 CATGGGAGGTTGGCAGGGGTCGG - Intergenic
1127584089 15:60365872-60365894 CATCAGAGGGAGACCGTGGAGGG - Intronic
1127865851 15:63032084-63032106 CATGACAGGGAGCCCAGGGTGGG - Intergenic
1128769151 15:70268856-70268878 CATGAGGAGGAGGGCGGGCTGGG + Intergenic
1129771380 15:78205430-78205452 GATGAAAGGGAGGCAGGGGCTGG + Intronic
1130111850 15:80971836-80971858 CTTGGGAGGGAGGCTGAGGTGGG + Intronic
1130982879 15:88824928-88824950 CATGATAGGGAGGGAGGGATAGG + Intronic
1131333092 15:91520718-91520740 CATGATTGGGAGGCTGAGGTGGG - Intergenic
1131777636 15:95819603-95819625 CATGAGATGGTGGCCGGGCATGG + Intergenic
1131969944 15:97881781-97881803 CAGGAGAGGGAGGCAAGCGTGGG + Intergenic
1132806143 16:1776028-1776050 CATGAGAGGGCGCCTGGGGACGG - Intronic
1132864907 16:2088468-2088490 CACCAGAGGTAGGCTGGGGTTGG - Exonic
1132942384 16:2514494-2514516 GGCGAGAGGGAGGCTGGGGTGGG + Intronic
1133490670 16:6264986-6265008 CATGGGAGGCAGGACGAGGTTGG - Intronic
1133701900 16:8316643-8316665 AGTGAGATGGAGGCCGGGCTCGG - Intergenic
1134015854 16:10887783-10887805 CATGAGAAGGAGGCCAGGGGTGG - Intronic
1134171869 16:11975835-11975857 CATGATTGGGAGGCCAAGGTGGG - Intronic
1134260562 16:12647866-12647888 CATGTTAGGGAGGCTGGGCTTGG - Intergenic
1134506025 16:14807645-14807667 CATGATTGGGAGGCCGGGGCAGG + Intronic
1134574525 16:15321129-15321151 CATGATTGGGAGGCCAGGGCAGG - Intergenic
1134727889 16:16435173-16435195 CATGATTGGGAGGCTGGGGCAGG + Intergenic
1134939548 16:18276654-18276676 CATGATTGGGAGGCCGGGGCAGG - Intergenic
1135079389 16:19421326-19421348 CATGAGAGGGACGCTGTGGGAGG + Intronic
1135273352 16:21087649-21087671 TATGAGAGGGAGGCTGAGGCAGG + Intronic
1135547151 16:23374035-23374057 CCTGTGATGGAGGCTGGGGTGGG - Intronic
1136555989 16:31008229-31008251 CAAGAGGGGGCGGGCGGGGTGGG - Intronic
1136558795 16:31025991-31026013 CCTGAGACGGGGGCCGGGGGAGG + Intergenic
1136571961 16:31103654-31103676 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1136649070 16:31650663-31650685 CATGACAGTGAGGCCGGGTGTGG + Intergenic
1138460661 16:57145898-57145920 CATGAGAGGCCTGCAGGGGTGGG + Intronic
1138699493 16:58847020-58847042 CATGAGAGGGAGACCGTGGAGGG + Intergenic
1139556166 16:67712309-67712331 CATCAGAGGGAGACCGTGGAGGG - Intronic
1139625874 16:68188008-68188030 CATGGGAGGGAGGTCGAGGTAGG - Intronic
1139847217 16:69929542-69929564 GCTGAGAGGGGGGCCGGGCTGGG + Intronic
1139864026 16:70050350-70050372 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1139899958 16:70320480-70320502 CTTGGGTGGGAGGCCGAGGTGGG - Intronic
1139949144 16:70660810-70660832 AATGAGAGGGATGCCAGGGATGG + Intergenic
1140136145 16:72207226-72207248 CATGAGGAGGAGGCTGGGCTAGG + Intergenic
1140450738 16:75068956-75068978 GAAGAGAGGGAGGAGGGGGTGGG - Intronic
1141000490 16:80302932-80302954 CATGAGAGGGACCCCGTGGGAGG + Intergenic
1141569714 16:84927200-84927222 TTTGAGAGGGAGGCCGAGGCAGG + Intergenic
1142135359 16:88449505-88449527 CAGAAGCTGGAGGCCGGGGTGGG - Intergenic
1142818397 17:2446633-2446655 CATCAGAGGGAGACCGTGGAAGG - Intronic
1142899471 17:3003376-3003398 CCGGAGAGGGAGGCAGGGATAGG - Intronic
1143110508 17:4550213-4550235 CGTGACAGGGAGGCCTTGGTTGG + Exonic
1143451239 17:7038178-7038200 CAGGACAGGCAGGCCAGGGTCGG - Exonic
1143465127 17:7131390-7131412 CCAGAGAGGGAGGCAGGGGCTGG + Intergenic
1143756691 17:9072662-9072684 AGTGAGTGGGAGGCAGGGGTGGG + Intronic
1143771485 17:9171760-9171782 GAAGAGAGGGAGGAAGGGGTGGG + Intronic
1143885473 17:10061782-10061804 CCTGAGAGGGAGGCTGGGAGTGG - Intronic
1143977934 17:10844116-10844138 CATGGGAAGGAGTCCGGGGTGGG + Intergenic
1144454072 17:15404620-15404642 CAGGGGAGGGAGGCCTGGGCAGG + Intergenic
1144506185 17:15833264-15833286 AGTGCGAGGGAGGCCGGGCTCGG + Intergenic
1144889209 17:18484456-18484478 CTTGGGAGGGAGGAAGGGGTGGG - Intronic
1145109306 17:20147928-20147950 CTTGGGAGGGAGGCTGAGGTGGG + Intronic
1145142999 17:20459840-20459862 CTTGGGAGGGAGGAAGGGGTGGG + Intronic
1145170360 17:20651194-20651216 AGTGCGAGGGAGGCCGGGCTCGG + Intergenic
1145321530 17:21769989-21770011 CAGGGGAGGGCGCCCGGGGTGGG + Intergenic
1145792873 17:27638845-27638867 CTTGGGAGGGAGGAGGGGGTGGG - Intronic
1145807737 17:27746714-27746736 CTTGGGAGGGAGGAGGGGGTGGG - Intergenic
1146216591 17:30981332-30981354 CATCAGAGGGAGACCGTGGAGGG + Intronic
1146359119 17:32159733-32159755 CATGGGAGGGAGGCTGAGATGGG + Intronic
1146444673 17:32923793-32923815 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1146581175 17:34040043-34040065 CACGAGAGGGCGGGCGGGGGAGG + Intronic
1146649148 17:34596015-34596037 CGTGAGAGGGAGAGAGGGGTTGG - Intronic
1146689485 17:34863356-34863378 CTGGAGTGGGAGGCAGGGGTTGG - Intergenic
1147007582 17:37416364-37416386 ATTGAGAGGGAGGCCGAGGCAGG - Intronic
1147947491 17:44088257-44088279 CCTGATTGGGAGGCCGAGGTGGG - Intronic
1148160277 17:45445875-45445897 CATTAGAGGGAGAGCGGGTTTGG - Intronic
1149256896 17:54837016-54837038 CATGGGAGGGAAGCTGAGGTGGG - Intergenic
1149292574 17:55231737-55231759 CATGAAAGGGAGTCCGGGGATGG - Intergenic
1149484178 17:57029046-57029068 CCTGATTGGGAGGCCGAGGTGGG - Intergenic
1150108590 17:62479103-62479125 CACGAGAGGGCGGGCGGGGGAGG - Exonic
1150226425 17:63527076-63527098 CAGGAAAGGCAGGCTGGGGTGGG - Intronic
1150281086 17:63930006-63930028 CACAAGAGGCAGGCCGGGCTAGG + Intronic
1150391568 17:64792754-64792776 CATTAGAGGGAGAGCGGGTTTGG - Intergenic
1150521000 17:65866346-65866368 CATGGGAGGGAGGCCAAGGCGGG + Intronic
1150631639 17:66884507-66884529 CACGAGAGAGAGGCCTGGTTGGG - Exonic
1151048399 17:70948275-70948297 CATGAGGTGGGGGCCGGGCTAGG - Intergenic
1151145154 17:72033648-72033670 CATGAGGTGGGGGGCGGGGTAGG + Intergenic
1151536508 17:74741914-74741936 CAGGAGAGGGAGACCGAAGTGGG + Intronic
1152019940 17:77775688-77775710 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1152101777 17:78305666-78305688 CATGAGAAGGAAGCTGGGGATGG + Intergenic
1152336010 17:79700560-79700582 GATGAGGGGGAGGGCAGGGTGGG + Intergenic
1152385043 17:79968561-79968583 CAAGAGAGTGAGGCCGGGCACGG + Intronic
1152530315 17:80914718-80914740 CATGGGAGGGAGGCTGAGGGTGG + Intronic
1152568205 17:81109626-81109648 CCTGTGAGGGAGGCCGGGCCCGG + Intronic
1152701930 17:81823658-81823680 CAGGTGAGTGAGGCTGGGGTGGG - Intronic
1153007805 18:512993-513015 CTTGAGAGGGAGACCGTGGAAGG + Intergenic
1153242694 18:3045099-3045121 CCTGAGAGGGTGCCCGGAGTAGG + Intergenic
1153345385 18:4020216-4020238 CATGACAGGAAGTCGGGGGTTGG - Intronic
1153543777 18:6185431-6185453 GAGGAGAGGGAGGCTGGGGAAGG + Intronic
1153608132 18:6855021-6855043 CATGGGAGGGAGGCCGAGGTGGG + Intronic
1154013838 18:10598669-10598691 CATGATTGGGAGGCTGAGGTGGG - Intergenic
1155067552 18:22280805-22280827 CATGGGAGAGAGGCAGGGTTTGG - Intergenic
1156290855 18:35747764-35747786 CATGGGGTGGAGGCGGGGGTGGG + Intergenic
1156323099 18:36046582-36046604 CACTATACGGAGGCCGGGGTGGG + Intronic
1156460095 18:37316779-37316801 CAGGTGAGGGAGGCAGGGCTAGG - Intronic
1156844304 18:41646461-41646483 CAGGAGAGGGAGGTCAGGGCTGG - Intergenic
1157739421 18:50079443-50079465 TGTGAGAGGGAGGCAGTGGTTGG - Intronic
1157818485 18:50748498-50748520 CAGGAGAGGGAGGCAGGTCTAGG - Intergenic
1158446625 18:57527757-57527779 GATGAAAGGGAGGCCGAGGCCGG - Intergenic
1159334308 18:67043767-67043789 CATGGGAGAGAGGCCAAGGTGGG + Intergenic
1160665491 19:326140-326162 CATGGGAGGGATGCCAGGTTGGG + Intronic
1160947511 19:1650653-1650675 CCTCAGAGGAAGCCCGGGGTTGG - Intronic
1161040433 19:2108303-2108325 CAGGAGAGGGAGGCCCGGAGCGG + Intronic
1161065649 19:2236101-2236123 CAGGGGCGGGAGGCCGGGGCCGG - Intronic
1161290349 19:3490766-3490788 CGTGGGAGGGAGGGAGGGGTGGG - Intergenic
1161337147 19:3720751-3720773 CCTGAGCGGGAGGCTGGGCTGGG + Intronic
1161471029 19:4456953-4456975 AAGGCCAGGGAGGCCGGGGTGGG - Intronic
1162474624 19:10892536-10892558 CAGGAGAGGGAGGCCAGGCCGGG + Intronic
1162562368 19:11424076-11424098 CTTGGGAAGGAGGCCGGGGAGGG + Intronic
1162683083 19:12361743-12361765 CATCAGAGGGAGACCGTGGAGGG - Intronic
1162808899 19:13152781-13152803 CAAGGGAGGGGGGCCGGGGGTGG - Exonic
1163123764 19:15233178-15233200 AATGAGACGGAGGGCGGGGCCGG + Intronic
1163477227 19:17533452-17533474 AAGGAGAGGGAGGGAGGGGTGGG + Intronic
1163559441 19:18010131-18010153 CATAGGAGGGAGGTGGGGGTTGG + Intronic
1163638844 19:18450408-18450430 CATGAGGGTGAGGCGGGTGTGGG + Intronic
1163677167 19:18660865-18660887 CATGAGGAGGAGGCCTGGGGAGG + Intronic
1163725657 19:18921807-18921829 CATGAGAGGCAGGGCTGGGCAGG - Intronic
1163768672 19:19177813-19177835 CATCAGAGGCAGGCAGGGCTGGG + Intronic
1164451618 19:28370905-28370927 CAGGAGCGGGAGGCGGTGGTGGG + Intergenic
1164996074 19:32720797-32720819 CAGGTGGGGGAGGGCGGGGTGGG - Intronic
1165094673 19:33403573-33403595 CATGGGAGGGAGCCAGGGGGTGG + Intronic
1166109308 19:40612945-40612967 CATGAGTTGGAGGCTGGGGGAGG - Intronic
1166138154 19:40790019-40790041 CATGAGATGGGGTCAGGGGTTGG + Intronic
1166163267 19:40967413-40967435 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1166197353 19:41215886-41215908 AATGAGACGGGGGCCGGGCTTGG - Intergenic
1166410224 19:42551733-42551755 TAAGAGAGGGAGGCAGGTGTGGG + Intronic
1166536776 19:43579606-43579628 AATGAAAGGGAGGCCGGGCACGG + Intronic
1166814929 19:45538472-45538494 CATTTGTGGGAGGCCGAGGTGGG + Intronic
1167043380 19:47036063-47036085 GAGGAGACGGAGGGCGGGGTTGG - Exonic
1167080834 19:47275181-47275203 CAGGAGAGGGAGGCAGCGGCGGG - Exonic
1167218661 19:48182777-48182799 CGAGAGAGGCAGGCCGGGGGAGG + Intronic
1167565776 19:50255784-50255806 AATGACAGGGAGTACGGGGTAGG + Intronic
1167660801 19:50794900-50794922 CATGGGCGGGAGGCCGGGCCGGG - Exonic
1167937282 19:52919191-52919213 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1167971224 19:53188554-53188576 CATCAGAGGGAGACCGTGGAGGG + Intronic
1168055906 19:53865207-53865229 TTTGGGAGGGAGGCCGAGGTGGG - Intergenic
1168225719 19:54993596-54993618 CATGTTAGGGAGGCCAGGGTGGG + Intronic
1168277924 19:55287323-55287345 CTGGAGAGGGAGGATGGGGTAGG - Intronic
1168355640 19:55698117-55698139 GATGTGAGGGTGGCGGGGGTTGG + Intronic
925403798 2:3592220-3592242 CATCAGAGGGAGACCGTGGAAGG + Intergenic
927705722 2:25295255-25295277 CATGATAGGGAGGCGGGGGCTGG - Intronic
927754519 2:25698059-25698081 GAGGAGAGGGAGGCTGGGGCCGG + Intergenic
927848262 2:26483255-26483277 CATGAGAGGGAGGAGAGGCTGGG - Intronic
927864788 2:26581479-26581501 CACGAGATGCAGGCCGGGGAGGG - Intronic
927872606 2:26633225-26633247 CATGAGAGGGTGGCAAGGGCTGG - Intronic
928003399 2:27541367-27541389 CATCAGAGGGAGACCGTGGAAGG + Intronic
928005612 2:27558873-27558895 CATCAGAGGGAGACCGTGGAGGG + Intronic
928353199 2:30582202-30582224 CATGGGAGGGGGGCAGGGGCAGG - Intronic
928558278 2:32448623-32448645 CATCAGAGGGAGACCGTGGAAGG + Intronic
929014523 2:37481476-37481498 CATGGGAGGGAGGCCAAGGTGGG + Intergenic
929579141 2:43070764-43070786 CAAGAGAGAGAAGCCCGGGTGGG + Intergenic
929739360 2:44587499-44587521 CATCAGAGGGAGACCGTGGAAGG - Intronic
930804080 2:55472587-55472609 CAGGAGAGGGAGGCCAAGGCAGG + Intergenic
931429082 2:62195653-62195675 CTGGAGGGGGCGGCCGGGGTCGG + Intergenic
932117623 2:69067695-69067717 CATGACGGGGAGGCTGGGATAGG - Intronic
932429568 2:71666038-71666060 AATGAGAAGGAGGAGGGGGTGGG - Intronic
934492029 2:94767982-94768004 GATGGGAGGGGGGCCGGGGGTGG - Intergenic
935136499 2:100308077-100308099 GATGGGAGGGAGGCCGGGCGTGG + Intronic
935586178 2:104802011-104802033 CATGAGTGAGTGGCAGGGGTTGG - Intergenic
935630991 2:105211888-105211910 CATCAGAGGGAGACCGTGGAAGG + Intergenic
935685016 2:105675426-105675448 CTTGCGTGGGAGGCAGGGGTGGG - Intergenic
936093926 2:109517574-109517596 CATGAGAGGAGGGCCTGGGCAGG - Intergenic
936166079 2:110120791-110120813 CATGGGAGGGCGGCCAGGGCGGG - Intergenic
937485861 2:122314191-122314213 CTTGGGAGGGAGGCTGAGGTGGG + Intergenic
937913420 2:127087375-127087397 GATGAGAGAGAGGACGGGGAGGG - Intronic
937993239 2:127675374-127675396 GGTGAGAGTGAGGCGGGGGTGGG + Intronic
938493736 2:131780194-131780216 CTTGGGAGGGAGGCTGAGGTGGG - Intergenic
938533632 2:132220387-132220409 CATCAGAGGGAGACCGTGGAAGG - Intronic
940643095 2:156367584-156367606 CATCAGAGGGAGACCGTGGAGGG - Intergenic
941151369 2:161919188-161919210 CATGAGATGGAGGCCAAGGTGGG + Intronic
942792613 2:179778015-179778037 CTTGACAGGGAGGCTGAGGTGGG - Intronic
943358041 2:186883087-186883109 CATGAGAGGGAGGAGGGTCTGGG + Intergenic
943396212 2:187338641-187338663 CATGGGAGGGAGGCAGAGGTGGG - Intergenic
943740185 2:191399238-191399260 CATCAGAGGGAGACCGTGGAAGG + Intronic
944186056 2:196950028-196950050 GATGAGTGGGAGGCCGGGCATGG - Intergenic
945232781 2:207609821-207609843 CATCAGAGGGAGACCGTGGAGGG - Exonic
945306802 2:208266456-208266478 CATGGGAAGGAGGCCGGTATGGG + Intronic
945835983 2:214836327-214836349 CATCAGAGGGAGACCGTGGAGGG + Intergenic
946197496 2:218043881-218043903 CATGGGAGGGAAGCCGAGATGGG - Intronic
948784362 2:240344139-240344161 CAGGAGAGAGAGGCCTGTGTTGG + Intergenic
948880470 2:240854733-240854755 CCTGAGATGCAGGCCAGGGTGGG + Intergenic
948883419 2:240871547-240871569 CATGTGACAGAGGCTGGGGTGGG - Intronic
948992245 2:241561075-241561097 CATGAGAGGCTGGCTGGGGGCGG - Intronic
1168848229 20:959565-959587 CATGAGAGGGAGGCCTGTGGGGG + Exonic
1169085497 20:2823089-2823111 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1169246719 20:4031872-4031894 CATCAGAGGGGGGCGGGGGAGGG - Intergenic
1170014578 20:11766325-11766347 AATGAGAGGAAGGCAGGGGTAGG - Intergenic
1170458323 20:16553982-16554004 CATGGGAGGGAGGCTGAGGTGGG + Intronic
1170940723 20:20845878-20845900 CTTGAAAGGGAGGTTGGGGTGGG + Intergenic
1171312118 20:24152990-24153012 CATGATAGGGAAGCAGGCGTAGG - Intergenic
1172541535 20:35721175-35721197 TTTGGGAGGGAGGCCGAGGTGGG - Intronic
1172703098 20:36864258-36864280 CAGGAGAGGGAAGCCGAGGCAGG - Intergenic
1172849214 20:37948511-37948533 CAGGAGAGGGAGGCTGAGGCAGG + Intergenic
1173225823 20:41161940-41161962 CATGAGAGGGAGGAAGGAGGAGG - Intronic
1174194082 20:48760637-48760659 CAGGAGAGGGAGGCTGGACTAGG + Intronic
1174562677 20:51442791-51442813 CCTGAGAGGGAGGCTGGGCATGG + Intronic
1175522593 20:59611692-59611714 CCGGAGAGGGAGGCAGGGGTAGG - Intronic
1175568634 20:60001193-60001215 GATGAGAGGGAGGGCGCGGTGGG - Intronic
1176113596 20:63421708-63421730 CATGAGGGGGCAGCCGGTGTTGG + Intronic
1176236577 20:64056388-64056410 CATCCAAGGGAGGCCTGGGTGGG + Intronic
1176425759 21:6547426-6547448 CATGAGAGGGTTGCTGGTGTAGG - Intergenic
1176614170 21:9014182-9014204 CTTGGGAGGGAGGCTGAGGTGGG + Intergenic
1176619599 21:9047009-9047031 CAGCAGAGGAAGACCGGGGTAGG + Intergenic
1176993164 21:15522385-15522407 CATGGAAGGGAGGTCGAGGTGGG - Intergenic
1177037457 21:16061090-16061112 CATGGGAAGGAGGCCGAGGTGGG - Intergenic
1177344681 21:19854079-19854101 CATGGGAGGGAGGCCGAGGTGGG - Intergenic
1177355304 21:19999025-19999047 CATCAGAAGGAAGCCTGGGTAGG - Intergenic
1177552037 21:22635591-22635613 GAAGAGAGGGAGGCCGGGCACGG - Intergenic
1177773499 21:25543607-25543629 CAAGAGAGGGAGTCGGGTGTGGG + Intergenic
1178704702 21:34863798-34863820 CATGATTGGGAGGCCAAGGTGGG - Intronic
1178725968 21:35051871-35051893 CATGGGTGGGGGGGCGGGGTGGG + Intronic
1178947344 21:36959357-36959379 GATGGGAGGGAGGCCGAGGAGGG + Intronic
1179701250 21:43155743-43155765 CATGAGAGGGTTGCTGGTGTAGG - Intergenic
1179802143 21:43816180-43816202 CAGGAGAGGGAGGCAGGGGCCGG - Intergenic
1179811676 21:43875223-43875245 CACGGGAGGGAGGCCGAGGAGGG - Intronic
1180025830 21:45161534-45161556 CATGAGAGGGAGGCCAACGCGGG + Intronic
1180098712 21:45574390-45574412 CGTGAGAGCCGGGCCGGGGTGGG - Intergenic
1180497939 22:15906244-15906266 CTTGGGAGGGAGGCTGAGGTGGG - Intergenic
1181414665 22:22750715-22750737 AATGAGAGGCAGGCCGAGGTGGG - Intronic
1181585944 22:23853838-23853860 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1181928243 22:26377687-26377709 CATCAGAGGCAGGCGGAGGTTGG - Exonic
1182009270 22:26986702-26986724 CATGGAAGGGAGGCTGGAGTGGG + Intergenic
1182176238 22:28292432-28292454 CAGGAGTTGGAGGCCGAGGTGGG - Intronic
1182276924 22:29195665-29195687 CAGGAAAGGGAGGCCAGGGAGGG - Intergenic
1182345863 22:29664308-29664330 CCTGAGAGGGAGGAAGGGGTGGG - Intronic
1182538722 22:31026313-31026335 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1182766460 22:32761334-32761356 CATGAGAGAGAGGCAAGGGGTGG + Intronic
1182930784 22:34172409-34172431 CATAATTGGGAGGCCAGGGTAGG + Intergenic
1183024997 22:35058370-35058392 CATGGGAGGGAAGCCGAGGAGGG - Intergenic
1183198959 22:36372863-36372885 CTTGAGTGGGGAGCCGGGGTTGG + Intronic
1183361445 22:37385141-37385163 CCTGAGAGGTAGCCCGGGGAGGG + Intronic
1183395547 22:37568953-37568975 CATGGGAGGGAGGACAGGGAAGG + Exonic
1183436361 22:37797873-37797895 CTTGAGATAGAGGCGGGGGTGGG - Intergenic
1183782824 22:40009572-40009594 CCTGAGAAGGTGCCCGGGGTGGG + Intronic
1183964406 22:41432808-41432830 TTTGAGAGGGAGGCCAAGGTGGG + Intergenic
1184114028 22:42411699-42411721 CATGATGGGCAGGCCGGTGTGGG + Exonic
1184147033 22:42617776-42617798 CTGGAGAGGGAGGCGGGGCTAGG - Intergenic
1184201197 22:42971109-42971131 CATCAGAGGGAGACCGTGGAGGG - Intronic
1184202453 22:42980510-42980532 CATCAGAGGGAGACCGTGGAGGG - Intronic
1184645100 22:45891203-45891225 CAGGAGAGGGAGGGCGGTGCTGG - Intergenic
1184672394 22:46021661-46021683 CATGTGAGGGAGGCAAGGGGTGG + Intergenic
950910980 3:16591539-16591561 CTTCAGAGGGAGGCTGAGGTAGG - Intronic
951016977 3:17742368-17742390 GCTGAGTGGGAGGCCGGGGCGGG + Intronic
952793296 3:37217424-37217446 TACGAGAGGGAGGCTGAGGTGGG + Intergenic
953511281 3:43542294-43542316 AATGAGAGGGAGGGAGGGCTAGG + Intronic
953606079 3:44414199-44414221 CATGAGTGGGAGGCCAGGCTTGG + Intergenic
954389417 3:50260876-50260898 CCTGGGTGGGAGGCCGGGGCAGG - Intergenic
954399787 3:50312948-50312970 CATCAGAGGGAGACCGTGGAGGG + Intergenic
954464317 3:50645799-50645821 CAGGAGATGGAGGCAGGGGGTGG - Intronic
954624652 3:52015956-52015978 CATGCGATGGAGGCTGGGGGTGG + Intergenic
954633092 3:52057379-52057401 GTTGAGAGGGAGGCAGGGGAAGG - Intergenic
954754732 3:52833062-52833084 ATTGAGAGGGAGGACAGGGTGGG - Intronic
955231381 3:57102012-57102034 CATGAGAGGGAGGCTGAGGCAGG + Intronic
956033160 3:65061310-65061332 AATGAGAGGGAGGCTGTGGTTGG + Intergenic
959415920 3:106075761-106075783 CATCAGAGGGAGACCGTGGAGGG + Intergenic
959849615 3:111071590-111071612 CATGTGTAGGAGGGCGGGGTGGG + Intronic
960116271 3:113896106-113896128 CATGAGAGTGAGGCAGGGAGAGG - Intronic
960405355 3:117252997-117253019 CAAGAGAGAGAGGTCTGGGTAGG - Intergenic
960780797 3:121314567-121314589 CATCAGAGGGAGACCGTGGAGGG + Intronic
961524958 3:127490800-127490822 CATGAGAGGAAGGCAAGGGGGGG - Intergenic
961669211 3:128516869-128516891 CATAAGAGGGAGGCAGAAGTGGG + Intergenic
961987587 3:131154123-131154145 CAGGAGAGGGAGGCAGGCTTAGG + Intronic
963136293 3:141908430-141908452 CATAAAAGGGAAGACGGGGTGGG - Intronic
963366185 3:144337473-144337495 CATGAGAGGAAGGAGGGGGAAGG - Intergenic
963911782 3:150821809-150821831 CATCAGAGGGAGACCGTGGACGG + Intergenic
965074010 3:163953598-163953620 CATAGGAGGGAGGCTGGGGTGGG - Intergenic
965727268 3:171731489-171731511 AATGAGAGGGAGGCTGGGCACGG + Intronic
966593950 3:181710608-181710630 GATGAGATGGGGGCGGGGGTAGG - Intergenic
966783686 3:183607362-183607384 CATCAGAGGGAGACCGTGGAAGG - Intergenic
966808995 3:183827006-183827028 CATGAGAGGGAGGCAGGCTGGGG + Intergenic
966881182 3:184352199-184352221 CATGGGAGGGACCACGGGGTTGG - Intronic
968075833 3:195815806-195815828 AAGGAGAAGGAGGCCGGGCTGGG - Intergenic
968075845 3:195815851-195815873 AAGGAGAAGGAGGCCGGGCTGGG - Intergenic
968075857 3:195815896-195815918 AAGGAGAAGGAGGCCGGGCTGGG - Intergenic
968075869 3:195815941-195815963 AAGGAGAAGGAGGCCGGGCTGGG - Intergenic
968075894 3:195816031-195816053 AAGGAGAAGGAGGCCGGGCTGGG - Intergenic
968075906 3:195816076-195816098 AAGGAGAAGGAGGCCGGGCTGGG - Intergenic
968075918 3:195816121-195816143 AAGGAGAAGGAGGCCGGGCTGGG - Intergenic
968075930 3:195816166-195816188 AAGGAGAAGGAGGCCGGGCTGGG - Intergenic
968075942 3:195816211-195816233 AAGGAGAAGGAGGCCGGGCTGGG - Intergenic
968075954 3:195816256-195816278 AAGGAGAAGGAGGCCGGGCTGGG - Intergenic
968076115 3:195816858-195816880 AAGGAGAAGGAGGCCGGGCTGGG - Intergenic
968076128 3:195816902-195816924 AAGGAGAAGGAGGCCGGGCTGGG - Intergenic
968076215 3:195817203-195817225 AAGGAGAAGGAGGCCGGGCTGGG - Intergenic
968076228 3:195817247-195817269 AAGGAGAAGGAGGCCGGGCTGGG - Intergenic
968076264 3:195817381-195817403 AAGGAGAAGGAGGCCGGGCTGGG - Intergenic
968076315 3:195817558-195817580 AAGGAGAAGGAGGCCGGGCTGGG - Intergenic
968296094 3:197577578-197577600 CATTACAGGGAGGCCGGGGGAGG + Intergenic
968377512 4:55175-55197 CATGGGTGGGAGGCCGGGCGCGG - Intronic
968506991 4:975366-975388 CATCAGAGGGAGACCGTGGAAGG - Intronic
968551086 4:1223665-1223687 CCTGAGAGGGTGGGCGGGGGTGG - Intronic
968709115 4:2099749-2099771 CATAACAGGGAAGCAGGGGTGGG + Intronic
968997618 4:3955589-3955611 CATGAGGGCGAGGCCTGGGGAGG + Intergenic
969568759 4:7995792-7995814 CATGTGAGAGGGGCGGGGGTCGG + Intronic
970127902 4:12834902-12834924 TATGAGAAGGAGGCCGGGTGTGG - Intergenic
970238414 4:13982153-13982175 CTTGAGAGGGAGCCCTGGGGAGG - Intergenic
970409072 4:15790206-15790228 CATCAGAGGGAGACCGTGGAAGG - Intronic
971408723 4:26347242-26347264 CAAGAGAGAGAGGTCAGGGTCGG + Intronic
971834690 4:31748247-31748269 CATGTGAGGGAGGTGGGGGAGGG - Intergenic
972564540 4:40258428-40258450 AAAAAGATGGAGGCCGGGGTGGG - Intergenic
972653990 4:41048696-41048718 CATCAGAGGGAGACCGTGGAAGG - Intronic
972695601 4:41442781-41442803 CAATAGAGGGAGGAAGGGGTAGG - Intronic
972995077 4:44869866-44869888 CACCAGAGGGAGGCCTGGTTGGG - Intergenic
973165465 4:47071526-47071548 CTTGAGAGGGGAGCAGGGGTTGG - Intronic
974016897 4:56656189-56656211 CCAGGGAGGGAGGCCCGGGTGGG - Intronic
974036515 4:56822503-56822525 CTTGGGAGGGAGGCTGAGGTGGG - Intergenic
974179002 4:58360638-58360660 CATGGGAGGGAGACTGAGGTGGG - Intergenic
974260331 4:59518128-59518150 CATGGGAGAGAGGCTGAGGTTGG - Intergenic
975685418 4:76916103-76916125 CATCAGAGGGAGACCGTGGAAGG - Intergenic
977143881 4:93411005-93411027 CAGGAGAGAGAGGCTAGGGTTGG - Intronic
977816283 4:101417041-101417063 CACAGGAGGGAGGCCAGGGTGGG - Intronic
978347691 4:107788758-107788780 CATGGGAGGGAGGCCAAAGTGGG - Intergenic
978408967 4:108408843-108408865 CATCAGAGGGAGACCGTGGAAGG - Intergenic
979273574 4:118791548-118791570 CATCAGAGGGAGACCGTGGAGGG - Intronic
979649007 4:123107740-123107762 CATGGGAGGGAGGCTGAGGAGGG - Intronic
979876572 4:125898883-125898905 GAAGAGAGGGAGGCGGGGGGAGG - Intergenic
980545932 4:134261232-134261254 CATGGGAGGGAGCCTGGGGGAGG - Intergenic
982040247 4:151390193-151390215 CATCAGAGGGAGACCGTGGAAGG - Intergenic
982121819 4:152150380-152150402 AATGGAAGGGAGGCTGGGGTTGG - Intergenic
982158097 4:152540731-152540753 CATGGGAGGGAGGCAAGGGTTGG - Intergenic
982545162 4:156724472-156724494 CATGGGAGGGAGGTGGAGGTGGG + Intergenic
983045349 4:162980256-162980278 CCTCAGAGGTAGGCAGGGGTAGG + Intergenic
983491853 4:168398398-168398420 CATGGGAGGGAGGCCAAAGTGGG + Intronic
984145806 4:176058718-176058740 CATGACAGAGAGACTGGGGTGGG + Intergenic
984702328 4:182826170-182826192 CAGGGGAGGGAGGCCGGAGCAGG + Intergenic
984804404 4:183737761-183737783 CATCAGAGGGAGACCGTGGAGGG + Intergenic
984920608 4:184761099-184761121 CATGAGAGTGGCCCCGGGGTGGG - Intronic
985305816 4:188538363-188538385 CATGACAAGGAGGCAGGGGGTGG + Intergenic
985542171 5:492264-492286 GAGGGGAGGGAGGTCGGGGTGGG + Intronic
985542228 5:492392-492414 GAGGGGAGGGAGGTCGGGGTGGG + Intronic
985667088 5:1186911-1186933 GATGAGTGTGAGGCCGGGCTGGG - Intergenic
987373354 5:17213084-17213106 TATGAAAGGGAGAACGGGGTTGG + Intronic
988204434 5:28115684-28115706 CATGGGAGGCAGGGCGGGGTGGG - Intergenic
988539202 5:32094080-32094102 CCTGAGAAGGAGGGAGGGGTTGG + Intronic
989588164 5:43089091-43089113 CATCAGAGGGAGACCGTGGAAGG + Intronic
989753713 5:44925616-44925638 GATGAGAAGGAGGCCGGGCGCGG - Intergenic
990210775 5:53480162-53480184 TGTGAGAGGGAGGGCGCGGTGGG - Intergenic
991375248 5:65958593-65958615 CATCAGAGGGAGACCGTGGAAGG + Intronic
993703390 5:91143867-91143889 CATGGGAGGGAGGCTGAGGGGGG - Intronic
993987013 5:94609700-94609722 CAGGAGTGGGAGGCCGAGGCAGG + Intronic
994753266 5:103764514-103764536 CATGAGAGGGAGGCTGAGAGAGG - Intergenic
996373205 5:122774990-122775012 CTTGAGAGGCCGGCCGGGGGCGG + Exonic
996688718 5:126313976-126313998 CATGATGGGAAGGCAGGGGTTGG - Intergenic
997343062 5:133161692-133161714 CATGAGAAGGAGGCAGAGGGAGG + Intergenic
997569631 5:134916176-134916198 CATGGGAGGGAGGCTAGGGTTGG + Intronic
997611685 5:135220085-135220107 CCTGAGAGGCTGGCAGGGGTTGG + Intronic
998072437 5:139208636-139208658 CTTTAGAGGGAGGCCGAGGTGGG - Intronic
999150764 5:149424457-149424479 CATGTGAAGGAGGCAGGGGTTGG + Intergenic
999282724 5:150375677-150375699 CGGGAGAGGGAGCCCAGGGTAGG - Intronic
1000103602 5:158037980-158038002 CATCAGAGGGAGACCGGGGAGGG + Intergenic
1000140394 5:158397653-158397675 CATGAGAGAGCGGCAGGAGTAGG - Intergenic
1000659626 5:163921171-163921193 CATGGGAGGGAGCCCATGGTTGG + Intergenic
1000779656 5:165465058-165465080 CATGAGGTGGAGGCAGGGCTAGG - Intergenic
1001240520 5:170066194-170066216 CATTTGCGGGAGGCCGAGGTGGG - Intronic
1001383824 5:171321641-171321663 AGGGAGAGGGAGGCCGGGGGAGG - Intergenic
1002285617 5:178160925-178160947 CCTGTAAGGGAGGCCGAGGTGGG - Intergenic
1002319682 5:178367594-178367616 CATGTTAGGGAGGCTGGGGGCGG + Intronic
1002322948 5:178386578-178386600 CACCAGAGGGGGGTCGGGGTGGG + Intronic
1002600623 5:180352543-180352565 CACGAGAGGGAGTCCGGGGCGGG - Intronic
1003062843 6:2876117-2876139 CGTGGGCGGGCGGCCGGGGTGGG + Intergenic
1003081507 6:3025162-3025184 CATCAGAGGGAGGGCGGCTTAGG - Intergenic
1003319629 6:5038849-5038871 CATCAGAGGGAGACCGCGGAAGG + Intergenic
1003923706 6:10857107-10857129 CATGATAGAGAGAACGGGGTGGG + Intronic
1004214142 6:13685817-13685839 AATGGGAGGGAGGCTGAGGTGGG + Intronic
1005452936 6:25991915-25991937 CTGGAGAGGGAGGTGGGGGTGGG - Intergenic
1006191146 6:32210311-32210333 CCTGAGAGGCAGGCAGGGCTGGG + Intronic
1006536411 6:34702600-34702622 CATGAGACAGAGGCCGGGCGCGG + Intergenic
1006682632 6:35808094-35808116 GATAAGAGAGAGGCCGGGGCAGG + Intronic
1006742241 6:36317486-36317508 CCAGAGATGGAGGCTGGGGTGGG - Intronic
1006766372 6:36510230-36510252 CATGAGAGGGAGGCCAAGCAGGG - Intronic
1007320766 6:41027662-41027684 CGTGGGTGTGAGGCCGGGGTAGG - Exonic
1007864685 6:44955606-44955628 CATGAGCTGGAGGCAGGGTTAGG - Intronic
1008231563 6:48989974-48989996 CATGAGAGAGAGGCTGAAGTGGG + Intergenic
1008480531 6:51981369-51981391 CATCAGAGGGAGACCGTGGAGGG - Intronic
1009790302 6:68393133-68393155 TGTGAGTGGGAGGCAGGGGTTGG + Intergenic
1011044686 6:83068044-83068066 CAGGTGAGGGAGGCCGGAGGCGG + Intronic
1011587762 6:88945082-88945104 CCTGAGAAGGAGGCAGGGGTTGG - Intronic
1012142057 6:95636618-95636640 CATGGGAGGGAGGCTGAGGTAGG - Intergenic
1012396036 6:98798558-98798580 TATGAATGTGAGGCCGGGGTCGG + Intergenic
1012889889 6:104885807-104885829 CACAAGAGGGAGGCCAAGGTGGG + Intergenic
1013530951 6:111018185-111018207 CATCAGGGGGAGACCGGGGAGGG + Intronic
1014969033 6:127791737-127791759 CATGGGAGGGAGGGTGAGGTGGG - Intronic
1015400238 6:132780343-132780365 CATAAGTGGGAGGCTGAGGTGGG - Intronic
1015954290 6:138583850-138583872 CATATGAGGGAGGCCAAGGTGGG + Intronic
1016085813 6:139913054-139913076 TATGATAGGGAGGCCGAGGCGGG + Intergenic
1016295544 6:142569747-142569769 CATGAGAGGGAGGCAGGAAGAGG + Intergenic
1016827846 6:148404758-148404780 GATGAGGGCGAGGCTGGGGTGGG - Intronic
1018046240 6:159969010-159969032 CGTGAGCGGGGGGCGGGGGTGGG + Intergenic
1019459303 7:1147934-1147956 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1019715176 7:2535260-2535282 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1019779539 7:2931204-2931226 CAGCAGAGGGAGGCCAGGGCGGG - Intronic
1020091429 7:5344460-5344482 CATGAGAGCGAGGAGGGGGAAGG + Intronic
1020150909 7:5680991-5681013 CATGAGAGGGAGTGAGGGGTGGG - Intronic
1021634941 7:22682790-22682812 CATGGCAGGGAGGTGGGGGTGGG + Intergenic
1021735151 7:23635906-23635928 CATCAGAGGGAGACCGTGGAAGG - Intronic
1022533027 7:31078881-31078903 CCTGAGAGGGAAGGCTGGGTGGG + Intronic
1023772971 7:43575962-43575984 TTTGGGAGGGAGGCCGAGGTGGG - Intergenic
1024008098 7:45242000-45242022 CATCATAGGGAGGCAGTGGTGGG - Intergenic
1024263174 7:47587048-47587070 CAGGAGAGGGAGCCTGGGGAGGG + Intergenic
1024480467 7:49856761-49856783 CATGATTGGGAGGCCGAGGTGGG + Intronic
1025979687 7:66395044-66395066 CATCAGAGGGAGACCGTGGAGGG + Intronic
1026392071 7:69912038-69912060 CACAAGAGGGAGGCCAAGGTAGG - Intronic
1026699284 7:72625548-72625570 CAGGAGCGGGAGGCTGAGGTGGG + Intronic
1027221576 7:76217529-76217551 CGTGATTGGGAGGCCGAGGTGGG - Intronic
1027251868 7:76403951-76403973 CATAAGAAGAAGGCCGGGCTCGG - Intronic
1028527452 7:91801530-91801552 CATGGGAGGGAGGCCAAGGAGGG - Intronic
1029479081 7:100802203-100802225 CTGGAGAGGGAGGCTGGGGCAGG - Intergenic
1029746357 7:102517626-102517648 CATGTGAGCGCGGCCGGGGGTGG - Exonic
1029764295 7:102616605-102616627 CATGTGAGCGCGGCCGGGGGTGG - Exonic
1030056307 7:105586673-105586695 CAGGAGAGTGAGGCCTGGGTAGG - Intronic
1030091461 7:105862325-105862347 CTTGGGAGGGAGGCTGAGGTGGG + Intronic
1030359414 7:108579618-108579640 CATGGGAGGGAGGCTGAGGTGGG + Intergenic
1031837070 7:126691167-126691189 CATGAGAGGGAGGCCAAGAAGGG - Intronic
1032188775 7:129750601-129750623 CAGGAGAGGGAGGCCATGATGGG - Intronic
1032513114 7:132487717-132487739 CATGAGAGGAAGACCCGGGAAGG + Intronic
1032514992 7:132500197-132500219 AATTGGAGGGAGGCCGAGGTGGG + Intronic
1032576604 7:133061129-133061151 CCTAAGAGGAAGGCCGGGGTGGG + Intronic
1032850055 7:135786599-135786621 CTTGATTGGGAGGCCGAGGTGGG - Intergenic
1033134171 7:138771087-138771109 GATAAGAGGAAGGCAGGGGTGGG - Intronic
1033256577 7:139806742-139806764 GATGAGAGGGAGGATGGGGAGGG - Intronic
1033323597 7:140361572-140361594 CATCAGAGGGAGACCGTGGAAGG - Intronic
1033794423 7:144831022-144831044 GATGAGAGGCAGGCTGGAGTCGG - Intronic
1033807872 7:144975313-144975335 CATGAGAAGCAGGATGGGGTGGG + Intergenic
1034496887 7:151428486-151428508 CATGGGAGGGAGGCCCAGGAAGG + Intergenic
1034961979 7:155368406-155368428 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1035053987 7:156021681-156021703 CATGGGAGGGCGGCCGGGCAGGG - Intergenic
1035189609 7:157154075-157154097 CTTGGGAGGGAGGCCGAGGTGGG + Intronic
1036797736 8:11768495-11768517 GAGGAGAGGGAGGCCTGGGGAGG - Intergenic
1038290148 8:26241932-26241954 CCTGGGAGGGAGGCTGAGGTGGG + Intergenic
1038395691 8:27243953-27243975 TGTGGGAGGGAGGTCGGGGTAGG - Intronic
1038594947 8:28880282-28880304 CATCAGAGGGAGACCGTGGAGGG - Intronic
1038745043 8:30247855-30247877 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1038745648 8:30252572-30252594 CATGAGAGGGAGGCCCTTGCTGG + Intergenic
1038785620 8:30612636-30612658 CAGGAGAGGGAGGCTGAGGCAGG - Intronic
1039325082 8:36476075-36476097 CATGAGAGCTGGGCAGGGGTCGG - Intergenic
1039607927 8:38898415-38898437 CATGAGAGGAGGGTGGGGGTGGG + Intergenic
1040070180 8:43181065-43181087 CATCAGAGGGAGACCGTGGAGGG + Intronic
1040818482 8:51533517-51533539 CATCAGAGGGAGACCGTGGAGGG - Intronic
1041216487 8:55606715-55606737 GATGAGAGTGGGGCTGGGGTAGG - Intergenic
1041305003 8:56448594-56448616 CAGGAGCGGGAGGCTGAGGTAGG + Intergenic
1042608974 8:70577169-70577191 CACGAGAGGGAGGCCGAGGGGGG + Intronic
1042856572 8:73273504-73273526 CACAGGAGGGAGGCCGAGGTGGG + Intergenic
1043798695 8:84579125-84579147 CATGGGAGGGAGGCCTAGGGGGG - Intronic
1044767908 8:95596865-95596887 CATGAGAGGGAGGGTGGAGATGG + Intergenic
1044774998 8:95678398-95678420 CATGGGAGTGAGGCCGAGGGGGG - Intergenic
1044992271 8:97806708-97806730 CATGAGATTGAGGCCGAGGCTGG + Intronic
1045120610 8:99029748-99029770 CATCAGAGGGAGACCGTGGAAGG + Intronic
1045362865 8:101449112-101449134 CCTGGGTGGGAGGTCGGGGTGGG + Intergenic
1045960395 8:107961306-107961328 CATCAGAGGGTGACCTGGGTGGG + Intronic
1046395318 8:113632968-113632990 CAGGAGAGGGAGGCCAAGGTGGG - Intergenic
1046636106 8:116678013-116678035 CATCAGAGGGAGACCGTGGAAGG - Intronic
1046674710 8:117094839-117094861 CATGGGAAGGAGGCTGAGGTGGG - Intronic
1047056760 8:121173718-121173740 CATGAGAGGGAACCCGTGGGAGG - Intergenic
1047314830 8:123723171-123723193 CATCAGTGGGAGGCAGGGGGAGG + Intronic
1047858331 8:128936969-128936991 CAGGAAAGGGAGGCCGGGGTGGG + Intergenic
1048912876 8:139152989-139153011 AATGTGAGGGAGTCAGGGGTAGG - Intergenic
1049010127 8:139881920-139881942 CATCAGAGGGAGGCCCAGGCAGG - Intronic
1049091449 8:140517651-140517673 CATCACTGGGAGGCCGAGGTGGG - Intergenic
1049334604 8:142076527-142076549 CATGAGAAGGAGCCGGGGGCAGG - Intergenic
1049585926 8:143432363-143432385 GTTGAGAGGGAGGCCCGGGAAGG + Intergenic
1049811943 8:144579576-144579598 GATGAAAGGGAGGCCAGGGATGG - Intronic
1050572028 9:6949814-6949836 CATCAGAGGGAGACCGTGGAGGG + Intronic
1051029656 9:12658712-12658734 CACGAGAGGGAGGCCAAGGCGGG - Intergenic
1051481949 9:17571076-17571098 GATCAGAGTGAGGCAGGGGTTGG - Intergenic
1052369874 9:27651930-27651952 CATGAGTGGGTGGGTGGGGTTGG + Intergenic
1053129181 9:35605587-35605609 CATGTGAGGCAGGCCCGGGCTGG + Exonic
1054377136 9:64457953-64457975 GATGGGAGGGGGACCGGGGTTGG + Intergenic
1055451630 9:76436196-76436218 TATAAGATGGAGGCCGAGGTAGG - Intronic
1055998660 9:82190807-82190829 CATGAGAGGGACCCAGGGGGAGG + Intergenic
1056167209 9:83951023-83951045 TTTGGGAGGGAGGCCGAGGTGGG + Intronic
1057509420 9:95665251-95665273 CATGATAGTGTGGCCGGGGCTGG - Intergenic
1057616382 9:96594427-96594449 CAGGAGAGGGTGGCCGCAGTTGG + Intronic
1057833633 9:98426752-98426774 TTTGGGAGGGAGGCCGAGGTGGG + Intronic
1059650260 9:116309625-116309647 CAGGAGAGGGAGGACGGGAGAGG + Intronic
1060251177 9:121987882-121987904 CAGGAGACAGAGGCCTGGGTTGG - Intronic
1061181102 9:129025768-129025790 CCTGTAAGGGAGGGCGGGGTGGG - Intronic
1061260519 9:129478357-129478379 CATGAGAGTGAGGCCAGGTGTGG + Intergenic
1061262276 9:129486953-129486975 CGTGAGAGGGAGGACGGCCTTGG + Intergenic
1061384733 9:130282547-130282569 CAGGCGAGGGAGGACAGGGTGGG + Intergenic
1061708771 9:132473087-132473109 TGTGAGAGGGAGTCAGGGGTTGG + Intronic
1062329086 9:136028956-136028978 CACAAGAGGGAGGCCGAGGTGGG + Intronic
1062488898 9:136794867-136794889 CCTGAGGGTGAGGCCTGGGTGGG + Intronic
1062599158 9:137312279-137312301 CCTGACTGGGAGGGCGGGGTGGG + Intronic
1062723767 9:138059385-138059407 CCTGGGAGGGAGGCAGGGCTGGG + Intronic
1203571725 Un_KI270744v1:139072-139094 CATGGGTGGGAGGCCGGGCGCGG + Intergenic
1185866926 X:3632371-3632393 CAGGTGAGGGAGGACGGGCTCGG - Intronic
1185935933 X:4257282-4257304 CATGAGAGGGAGGCCAAGGAAGG + Intergenic
1186453305 X:9691143-9691165 CATCAGAGGTAGGCCGGGCGTGG + Intronic
1187033130 X:15509227-15509249 CCTGAGAGGGAGATTGGGGTGGG - Intronic
1187515128 X:19962426-19962448 CATTTGTGGGAGGCCGGGGCAGG - Intronic
1188368141 X:29335235-29335257 CATCAGAGGGAGACCGTGGAGGG + Intronic
1188371060 X:29369869-29369891 CATGACAAGGAGTCCGAGGTAGG - Intronic
1188532326 X:31155881-31155903 CAGGAGGAGGAGGCTGGGGTGGG + Intronic
1189497272 X:41520606-41520628 GATGAGATGGAGGTAGGGGTGGG + Intronic
1189838235 X:45042224-45042246 CATCAGAGGGAGACCGTGGAAGG + Intronic
1192659439 X:73026833-73026855 CCTAAGAGGGAGGCTGGGCTAGG + Intergenic
1196469210 X:116006690-116006712 CTTGAGAGAGAGGCCTGGATTGG + Intergenic
1198189445 X:134287909-134287931 CATGGGAGGGAGGCAGAGGGGGG + Intergenic
1200076822 X:153555294-153555316 CAGGAGTGGGAGCCAGGGGTAGG - Intronic
1200093215 X:153645291-153645313 CATAGGAGGGAGGCCTGGGCTGG + Intronic
1200166340 X:154038222-154038244 CAAGGGAGGGAGGCTGGGCTAGG + Intronic