ID: 1126992691

View in Genome Browser
Species Human (GRCh38)
Location 15:54400604-54400626
Sequence CAAGGTTAACATCACTACAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 2, 3: 5, 4: 122}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126992691 Original CRISPR CAAGGTTAACATCACTACAA GGG (reversed) Intronic
901248435 1:7752705-7752727 CATGGTTACCAGCACTCCAAGGG - Intronic
903876118 1:26474039-26474061 AAAAGTGAACATCAGTACAATGG - Intronic
912227537 1:107752213-107752235 CAAGGTTAACACCATTAAATAGG + Intronic
913146469 1:115995176-115995198 CAAAATTAACATCACCACTAAGG - Intronic
914291393 1:146276948-146276970 CAATGTCAACATCTCTCCAAAGG + Intergenic
914552437 1:148727731-148727753 CAATGTCAACATCTCTCCAAAGG + Intergenic
918385995 1:184008089-184008111 CAAAATTAACATCACTAGAAAGG + Intronic
918612721 1:186511606-186511628 CAACATTAACATCAATAAAAAGG - Intergenic
918829013 1:189367325-189367347 TAAGGTAAATATCACTACACAGG - Intergenic
922140817 1:222884660-222884682 CAAAGTTAACATCACCAATAAGG - Intronic
1065542561 10:26784688-26784710 CAAGGGAAAAATCACTATAATGG + Intronic
1070303239 10:75220791-75220813 CAAAGTCAACATCACAACCAAGG - Exonic
1070484905 10:76920882-76920904 CAAGTTAAGCATAACTACAATGG - Intronic
1073830954 10:107382666-107382688 CAAGGATAACCTGACTACTATGG - Intergenic
1079517308 11:21284446-21284468 CAAGGTCAACATCACGAAACTGG + Intronic
1080062986 11:27977227-27977249 CAAGGTTAACGTCACCAGCAAGG - Intergenic
1080594738 11:33761466-33761488 AAAGGTTAAATTCACTACACAGG + Intronic
1085804984 11:79627472-79627494 CAAAGTTAACATCATTTTAATGG - Intergenic
1088590734 11:111400519-111400541 TAACTTTAACATCACTTCAAAGG + Intronic
1089157897 11:116416060-116416082 CAGGGTTAACTTCACCACAGAGG - Intergenic
1089799162 11:121010268-121010290 CAAGATTAACAACAAGACAAGGG + Intergenic
1090562565 11:127948147-127948169 CTAAGTTACCATCATTACAAGGG - Intergenic
1093355284 12:18159403-18159425 CAATGTTATCATCAGAACAAAGG - Intronic
1094361444 12:29635596-29635618 CAACTTTAACATCACTGAAAGGG + Intronic
1095753583 12:45737607-45737629 CAATCTTAGCATCACTAAAAGGG - Intronic
1098269214 12:68753741-68753763 GAAAGTTAACATGACTTCAAGGG - Intronic
1100350934 12:93781763-93781785 CATGCTAAACACCACTACAAGGG + Intronic
1104703093 12:130922052-130922074 CAAGGCTAACATAATTATAAGGG + Intergenic
1106652637 13:31708199-31708221 CATGGTTAACATCAGTGAAAAGG - Intergenic
1110489347 13:76085719-76085741 CAATTTTAACATCAATACCATGG + Intergenic
1111029686 13:82579125-82579147 CAAGGTTAATATCAATATATAGG + Intergenic
1112053068 13:95663334-95663356 CAAGTATAACATGACTAAAAAGG + Intergenic
1114208064 14:20591777-20591799 CAAGATTAACGTTATTACAAGGG - Intronic
1114539977 14:23448002-23448024 CAAGGTTAAGATCACTTAAGAGG + Intergenic
1120693175 14:87615982-87616004 CAAGGTTGTCATCAGTAAAATGG - Intergenic
1125031615 15:35081309-35081331 CAAGTGAAACATCTCTACAACGG + Intergenic
1126992691 15:54400604-54400626 CAAGGTTAACATCACTACAAGGG - Intronic
1127061031 15:55184726-55184748 CAAAGTTAACATCACCAGCAAGG + Intronic
1130190385 15:81729640-81729662 AGAGGTTAACATCACTTAAAGGG + Intergenic
1133814354 16:9184818-9184840 AAATGTTAACATCACCTCAAAGG - Intergenic
1134023190 16:10935656-10935678 CAAAGTTAACATCGCCAGAAAGG + Intronic
1134463854 16:14455552-14455574 CAAGGTTAACAGCACTACACAGG + Intronic
1148033746 17:44642151-44642173 CCAGGATAACATCATTATAATGG + Intergenic
1155585912 18:27364844-27364866 CAATGTAAACATCACCAGAATGG - Intergenic
1158083384 18:53620992-53621014 CAAACATAACATCACTACCATGG - Intergenic
1163097101 19:15067063-15067085 GAAGGTTAACATCACCAAGAAGG + Intergenic
1164745943 19:30613150-30613172 CAAAGTTAACATCACCAGTAAGG - Intronic
1164883489 19:31757505-31757527 CCATGTTAACTTTACTACAATGG - Intergenic
1165502669 19:36202556-36202578 CAAGTTTAGCATCACTAAGATGG - Intronic
929605269 2:43229769-43229791 CTAGATTAAAATCACTGCAAAGG + Intergenic
931737067 2:65205510-65205532 CAAAGTCAACATCACAACCAAGG - Intergenic
932246808 2:70203149-70203171 CAAAGTTAACAGCACTTCATTGG - Intronic
932643688 2:73479313-73479335 GAACATTTACATCACTACAAAGG + Intronic
934127434 2:88910970-88910992 CAAGGTTACAATGACAACAAAGG + Intergenic
937980756 2:127613805-127613827 CAAGGCTAAAATAACTAAAAAGG - Intronic
939060879 2:137420163-137420185 CAAGGTTAAAATCAAAACCACGG - Intronic
939339775 2:140879511-140879533 CAAGGTTAAGAACACTTCTAGGG - Intronic
940176055 2:150878682-150878704 CAAGGTTAAGATTACCACAGGGG - Intergenic
941879487 2:170466456-170466478 CAAGGTTACCACCAACACAATGG - Intronic
942314628 2:174686179-174686201 CAAAGTATACATGACTACAAAGG - Intergenic
942473002 2:176282063-176282085 GAAGGATAACATCTCAACAATGG - Intronic
942735130 2:179101727-179101749 CAATGGTAAGATCACTTCAATGG + Exonic
943553537 2:189371887-189371909 AAAGATTAACATGACTAAAATGG + Intergenic
946188172 2:217993390-217993412 CAAAGTTAACATCACTGCAACGG + Intronic
1171437646 20:25135606-25135628 CAAGGTTTCCATGACTACATGGG + Intergenic
1171442614 20:25177419-25177441 CAAAGTTAACATCACCAACAAGG + Intergenic
1173086801 20:39927619-39927641 CAATATTAACATCAGAACAAAGG + Intergenic
1178762363 21:35415467-35415489 CAATGTTAACATCACCAAAGAGG + Intronic
1180113687 21:45681156-45681178 CACTCTTAACACCACTACAATGG + Intronic
1182947027 22:34333547-34333569 CAAAGTTAACAGCACTTCATTGG + Intergenic
953155441 3:40367474-40367496 CAAGGTTAATATCAATATATGGG - Intergenic
956145031 3:66183546-66183568 CAGGGTCAACATCACGATAAAGG - Intronic
956904999 3:73756609-73756631 CAAGGCTAACATCCTTAAAATGG - Intergenic
959552186 3:107674404-107674426 AAAGTTTAAAATCAGTACAAAGG - Intronic
963134204 3:141885924-141885946 CAGGGTCAACAACACTACAGGGG - Intronic
964050424 3:152386027-152386049 CAAGGGGAAGATCATTACAAAGG - Intronic
965852592 3:173047927-173047949 CAAGTTTAAGTTCACTACTAGGG + Intronic
966207292 3:177418108-177418130 CAAGGTTAACATCACCAGCAGGG - Intergenic
972642703 4:40940152-40940174 CACAGGTAACAACACTACAATGG + Intronic
974402815 4:61426835-61426857 CAAAGTTAACAGCACTTCACTGG + Intronic
975889293 4:79006624-79006646 CAAAATTAACATCACCAAAATGG - Intergenic
977158484 4:93604481-93604503 CATTGTTAACATAACAACAAAGG + Intronic
981611724 4:146600286-146600308 CAAGGTTAACTTCAGGACATTGG + Intergenic
981969720 4:150652859-150652881 CAATATTAACATCACCAAAAAGG - Intronic
986604608 5:9509107-9509129 CCAGGACAGCATCACTACAAGGG + Intronic
989735638 5:44701258-44701280 CAAGGTTACCACCACTACTGGGG + Intergenic
991745095 5:69730945-69730967 CAACGATGACATCACTACTAAGG + Intergenic
991752610 5:69824277-69824299 CAACGATGACATCACTACTAAGG - Intergenic
991796664 5:70310674-70310696 CAACGATGACATCACTACTAAGG + Intergenic
991802228 5:70381013-70381035 CAACGATGACATCACTACTAAGG - Intergenic
991824474 5:70606259-70606281 CAACGATGACATCACTACTAAGG + Intergenic
991831929 5:70699406-70699428 CAACGATGACATCACTACTAAGG - Intergenic
991889043 5:71310231-71310253 CAACGATGACATCACTACTAAGG + Intergenic
994287563 5:97988457-97988479 AAAGGTTAACAACATTACCAAGG + Intergenic
996324417 5:122256761-122256783 GAAGGGTCAGATCACTACAAAGG - Intergenic
1004905035 6:20229665-20229687 CAATGAAAACATGACTACAAAGG - Intergenic
1006983595 6:38163745-38163767 GAATGTTAACATCATCACAACGG + Intergenic
1012074166 6:94662348-94662370 CAAGGATAACATCTCTTCTATGG - Intergenic
1015036698 6:128664450-128664472 CAAGCTTGACCTCACTACAAAGG - Intergenic
1015417513 6:132966511-132966533 CAAGGTCAACATCCCTAGATGGG - Intergenic
1016517595 6:144912627-144912649 AAAGATTAACTTCACCACAAGGG + Intergenic
1017478762 6:154828074-154828096 CAATCTTAACATCATTAAAAGGG - Intronic
1020970883 7:14936803-14936825 CAAGGTTCACATTCCTAGAAAGG - Intronic
1021743739 7:23716343-23716365 CAAGGTTATCATCAATAAGAAGG - Intronic
1024837473 7:53539365-53539387 CAAAATTATCATCACTATAAAGG - Intergenic
1025259761 7:57410987-57411009 CAAGGTGAACCTCACTTCCAAGG - Intergenic
1026119205 7:67521931-67521953 CAGCGTTAACATCAACACAAAGG + Intergenic
1028319154 7:89438345-89438367 CAAAGTTAACAGCACTTCATTGG - Intergenic
1028857737 7:95611037-95611059 AAAGGTTAGCATCAAAACAAAGG + Intergenic
1033929970 7:146508796-146508818 CAAAGTTAACAGCACTTCATTGG + Intronic
1038046891 8:23773119-23773141 GTGGATTAACATCACTACAAAGG + Intergenic
1041798052 8:61767714-61767736 CAAAGTTAACAGAACTAAAAAGG - Intergenic
1044006629 8:86944734-86944756 CAAGGTTAAAATCCCTTCATGGG - Intronic
1045742427 8:105377073-105377095 CAGGGTGAACAGCCCTACAATGG - Intronic
1046769765 8:118106694-118106716 CATAGTTCACATCCCTACAAAGG - Intronic
1046878727 8:119284622-119284644 CAAGGTTAATGTCCCTGCAAAGG + Intergenic
1046987795 8:120409176-120409198 CATGGTTAGCTTCTCTACAAAGG + Intronic
1047890999 8:129309900-129309922 AAAGCTTAACAACACTCCAAGGG - Intergenic
1056285711 9:85085740-85085762 CAATGTTAAGACCACTTCAAAGG + Intergenic
1058324162 9:103674672-103674694 CAAGGTTAACATAACCAGCAAGG - Intergenic
1061723446 9:132568027-132568049 CATGGTTCAGCTCACTACAAGGG + Intronic
1186490664 X:9969943-9969965 CAATGTTAGCATCACTGAAAGGG - Intergenic
1188446680 X:30260092-30260114 GAAGGCTAACATCACTAAATTGG + Intergenic
1190180617 X:48188624-48188646 GAAGATTAACAACCCTACAATGG + Intronic
1190641657 X:52486060-52486082 CAAGGTGAACCTCACTTCCAAGG + Intergenic
1190644189 X:52509737-52509759 CAAGGTGAACCTCACTTCCAAGG - Intergenic
1190646015 X:52526805-52526827 CAAGGTGAACCTCACTTCCAAGG - Intergenic
1193508585 X:82372322-82372344 CAAAGTTAACAGCACTTCATTGG + Intergenic
1196088910 X:111717621-111717643 CAAGATTAAAATCACTACTAAGG - Intronic
1198663134 X:138992931-138992953 CAAGGTTAACATCACCAGTAAGG + Intronic