ID: 1126997449

View in Genome Browser
Species Human (GRCh38)
Location 15:54461367-54461389
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 924
Summary {0: 1, 1: 4, 2: 166, 3: 304, 4: 449}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126997449_1126997451 -9 Left 1126997449 15:54461367-54461389 CCAAAACACTACTGGTCCCTAGC 0: 1
1: 4
2: 166
3: 304
4: 449
Right 1126997451 15:54461381-54461403 GTCCCTAGCATTTTAGATAAGGG 0: 1
1: 29
2: 356
3: 805
4: 901
1126997449_1126997450 -10 Left 1126997449 15:54461367-54461389 CCAAAACACTACTGGTCCCTAGC 0: 1
1: 4
2: 166
3: 304
4: 449
Right 1126997450 15:54461380-54461402 GGTCCCTAGCATTTTAGATAAGG 0: 1
1: 24
2: 331
3: 795
4: 944

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126997449 Original CRISPR GCTAGGGACCAGTAGTGTTT TGG (reversed) Intronic
900668191 1:3830398-3830420 GCTTAAGACCAGAAGTGTTTAGG - Intronic
900674183 1:3873856-3873878 GCTGGGGACCAGAAGTGTTTTGG - Intronic
901819524 1:11818441-11818463 GCTTGGGACCAGAAGTGTTTTGG - Intronic
901889070 1:12246515-12246537 GCTTGGGACAAGAAGTGTTCCGG - Intronic
902560082 1:17271907-17271929 GCAAAGCACCAGTAGGGTTTGGG + Intronic
902889433 1:19431333-19431355 GCTTGGGACCAGAAGCATTTTGG - Intronic
902891884 1:19450261-19450283 GCTGGGGACCTGAAGTGTTTTGG + Intronic
902929822 1:19723119-19723141 GCGTGGGACCAGAAGTATTTTGG + Intronic
903099648 1:21017820-21017842 GCTTGGGACCAGAAGAGTTTTGG - Intronic
903904061 1:26671056-26671078 GCTTGGGACCAGAAATGTTTTGG - Intergenic
903944495 1:26953040-26953062 GCTTGGGTCCAGAAATGTTTTGG + Intronic
904124590 1:28228727-28228749 GCTTGGGACCAGAAGTTTTTTGG - Intronic
904482720 1:30804233-30804255 GCTTGGGACCAGAAGTGTTTGGG + Intergenic
905199989 1:36308647-36308669 GCTTGGGACCAGAAGTGTTTCGG + Intronic
905679728 1:39860531-39860553 GCTTGGGACCAGAAGTGTTTTGG - Intronic
906392567 1:45431616-45431638 GCTGGGAACCAGAGGTGTTTTGG - Intronic
906947064 1:50303734-50303756 GCTTGGGACCAGAAGTGTTTTGG - Intergenic
906964867 1:50446499-50446521 GCATGGGACCAGAAATGTTTTGG - Intronic
907056164 1:51370319-51370341 GCTTGGGAGAAGGAGTGTTTTGG + Intronic
907063668 1:51457462-51457484 GCTTGGGACCAGAAGTGTTTTGG + Intronic
907168923 1:52442510-52442532 GCTTGAGATCAGAAGTGTTTTGG + Intronic
907741809 1:57173551-57173573 ACTTGGGACTAGCAGTGTTTCGG - Intronic
908033469 1:60027026-60027048 ATTTGGGACCAGAAGTGTTTTGG - Intronic
908231552 1:62110534-62110556 GATAGGGACGAATAATGTTTTGG + Intronic
908274617 1:62457413-62457435 GCTTAGGACCAGAAGTGTTTGGG - Intronic
908522401 1:64956946-64956968 GCCAGGCACCAGTAGGGTTGAGG + Intronic
908550060 1:65199734-65199756 GCTCGGGACCAGAAGTATTTTGG + Intronic
908634228 1:66144685-66144707 GTTTGGGACCAGAAGTCTTTTGG - Intronic
909001149 1:70219177-70219199 GCTTGGGACCATAAGTGTTTTGG - Intronic
910337563 1:86152538-86152560 GCCTGAGACCAGAAGTGTTTGGG - Intronic
910656771 1:89627995-89628017 CCTTGGGACCAGAAGTGTTCTGG - Intergenic
910921735 1:92355862-92355884 GCTTGGGACCAGAACTGTTTTGG - Intronic
910930633 1:92439795-92439817 GCTTGGGACCAGGAATATTTTGG + Intergenic
911758162 1:101584600-101584622 GCTTGGGACCAGAAGTGTTTTGG + Intergenic
911779604 1:101859542-101859564 GCTTGGGGACAGAAGTGTTTTGG + Intronic
912680960 1:111728802-111728824 GCTTAGGGCCAGAAGTGTTTTGG - Intronic
912693977 1:111826912-111826934 GCTTGGGACCAGAAGTGTTTTGG + Intronic
913253391 1:116931246-116931268 GTTTGGGACCAGAAGTGTTTGGG - Intronic
913961895 1:143345989-143346011 GCTTGGGACCAGAAGTGTTTTGG - Intergenic
914056250 1:144171563-144171585 GCTTGGGACCAGAAGTGTTTTGG - Intergenic
914122896 1:144794799-144794821 GCTTGGGACCAGAAGTGTTTTGG + Intergenic
914779231 1:150769226-150769248 TCTAGGAACTAGCAGTGTTTGGG + Intergenic
915192218 1:154161163-154161185 GCTTGGGAGCAGAAGTGTTTTGG - Intronic
916092849 1:161322035-161322057 GCTTGGGACCAGAAATATTTAGG + Intronic
916323473 1:163531996-163532018 GCTTAGGACCAGAAGTGTTTTGG + Intergenic
916359143 1:163948511-163948533 GCTTGGAACCAGAAGTGTTTTGG - Intergenic
916394982 1:164376315-164376337 GCATGGGACCAAAAGTGTTTTGG - Intergenic
916507392 1:165440384-165440406 GCTTAGCACCAGAAGTGTTTTGG + Intronic
916867318 1:168874436-168874458 GCTTGGGACCAGAAGTGTTTTGG - Intergenic
916906075 1:169285115-169285137 GCTTGTGACAAGCAGTGTTTTGG + Intronic
917098502 1:171423404-171423426 GTTAGGGACCAAAAGTTTTTAGG + Intergenic
917114223 1:171585829-171585851 GCTTGGGACCAGAAATGTCTCGG + Intronic
917213139 1:172650598-172650620 GCTTGGGACCAGAAGTGTTTTGG - Intergenic
917564691 1:176201216-176201238 GCTTGAGACCAGAAGTGTTTTGG - Intronic
917813258 1:178681284-178681306 GTTTGGGGCCAGAAGTGTTTTGG - Intergenic
918054540 1:181008321-181008343 GCTTGGGACCAGAAATGTTTGGG + Intronic
918091989 1:181304910-181304932 CCACGGGACCAGAAGTGTTTCGG + Intergenic
918603856 1:186397485-186397507 GCTTAGGACCAGAAGTGTTTTGG + Intronic
920840816 1:209552134-209552156 GCTTGGGACCAGAAGTGTTTTGG + Intergenic
921372773 1:214442205-214442227 GTTAGGGACGAGAAGTGTTTGGG + Intronic
922519414 1:226235475-226235497 GCTTGGGACCAGAAGTGTTTTGG + Intronic
922628505 1:227078968-227078990 GCTTGGGACCGGAAGTATTTTGG - Intronic
922970818 1:229736316-229736338 GCTTGGGACCAGAAATGTTTTGG + Intergenic
922988498 1:229885494-229885516 GCTTGGGTCCACAAGTGTTTTGG - Intergenic
923182902 1:231539317-231539339 GCTTGGGACTGGAAGTGTTTTGG + Intronic
923344876 1:233042105-233042127 ACTTGGGACCAGAAGTGTTTTGG - Intronic
923590744 1:235317022-235317044 GCTTGGGACCAGAAATATTTGGG - Intronic
923606974 1:235452982-235453004 GCCTGGGACCAGAAGTATTTAGG - Intronic
923662281 1:235968658-235968680 GCTTGGGAACAGAAATGTTTTGG + Intergenic
923917675 1:238527677-238527699 ACTTGGGACCAGAAGTGCTTTGG + Intergenic
924803749 1:247346782-247346804 GCTTGGGAGCAGTGGCGTTTTGG - Intergenic
924829311 1:247575995-247576017 GCTTGGGACCAGAAGTGTTTTGG + Exonic
1063214726 10:3913722-3913744 GCTTAGGACCAGAAGAGTTTTGG + Intergenic
1063567242 10:7181378-7181400 GCTTGGGACCAGAAGTGTTTTGG - Intronic
1063637894 10:7801592-7801614 GCTTAGGACCAGAAATGTTTGGG + Intronic
1063875275 10:10470123-10470145 GCTTGAGACCAGAAGGGTTTGGG - Intergenic
1064041083 10:11964802-11964824 GCCTGGGACCAGAAATGTTTCGG + Intronic
1064187722 10:13177351-13177373 GCTTGGGACCAGAACTGTTTTGG + Intronic
1064388090 10:14916563-14916585 GCTTGGGAGCAGAAGTGTTTTGG - Intronic
1064427167 10:15239835-15239857 GCTTGGGACCAGAAGTGTTTTGG + Intronic
1064480165 10:15732613-15732635 GCTTGGGACCAGAAGTGTCTTGG + Intergenic
1064569397 10:16676568-16676590 TCTTGGGACCAGAAGTATTTTGG + Intronic
1064801144 10:19073706-19073728 GCTTGGGACCAGAAGTGTTTTGG - Intronic
1065180281 10:23118006-23118028 GCTTAGGACCAGAAGTGTTTCGG - Intronic
1065408959 10:25400094-25400116 GCTAAAGACCAGTGGTGCTTAGG - Intronic
1065548280 10:26844295-26844317 TCTAAGGAACAGTAGTGTTTGGG - Intronic
1065622385 10:27595848-27595870 GCTTGTGACCAGAAGTGTTTTGG + Intergenic
1065684192 10:28267646-28267668 GCTTGGGACCAGAAGTGTTCTGG - Intronic
1065764891 10:29019516-29019538 TCTTGTGACCAGAAGTGTTTGGG - Intergenic
1065877420 10:30009664-30009686 GTTTGGGACCAGAAGAGTTTTGG + Intergenic
1066121601 10:32294276-32294298 GCTTGGGACCAGAAGTGTTTTGG + Intronic
1066432094 10:35362147-35362169 GCTTGGTACCAGAAGTGTTTTGG - Intronic
1066676227 10:37890180-37890202 GCTTGAGACCAGAAGTGTTTTGG - Intergenic
1067191722 10:44075761-44075783 CCTTAGGACCAGAAGTGTTTTGG - Intergenic
1067819252 10:49512636-49512658 GCTTGGGACAAGAAGTGTTTTGG + Intronic
1067910900 10:50345793-50345815 GCTTGGGACCAGAAGCGTTTCGG - Intronic
1067934904 10:50601741-50601763 GCTTGGAACCAGAAGTATTTTGG + Intronic
1067960759 10:50846341-50846363 GCTTAGGACCAGAAGTATTTTGG - Intronic
1068914684 10:62416677-62416699 GCTTGGGACTAGAAGTGTTTTGG + Intronic
1068948262 10:62751250-62751272 GCTTGGGACCAGAACAGTTTTGG + Intergenic
1069324616 10:67218123-67218145 GCTTGGGACCAGAAGTGGTTTGG - Intronic
1070697937 10:78576847-78576869 GCTTGGGACCAGAAGTGTTTTGG - Intergenic
1071447861 10:85765725-85765747 GCTTGGGACCAGAAGTGTTTTGG - Intronic
1071590406 10:86867319-86867341 GCTTGGGACCAGAAGTGTTTTGG - Intronic
1072006768 10:91258386-91258408 GGTTGGGACCAGAAGTTTTTTGG + Intronic
1072296802 10:94016289-94016311 ACTTGGGACCAGAAGTGTTTTGG + Intronic
1073211615 10:101808129-101808151 GCTTGGGACCAAAAATGTTTTGG + Intronic
1073504317 10:103970835-103970857 GCTTGGGACCAGAAGTGTTTTGG + Intronic
1074092269 10:110272301-110272323 GCTTAGGACCAGAAATGTTTTGG - Intronic
1074994945 10:118748723-118748745 GCTTGGGGCCAGAAGTGTTTTGG - Intronic
1075056081 10:119219468-119219490 GCTTGTGACCAGAAGTGCTTTGG - Intronic
1075193246 10:120330626-120330648 GCTTGGGACCAGAGGTGTTTGGG + Intergenic
1077621828 11:3731772-3731794 GCTTGGGTCCAGAAGTATTTTGG + Intronic
1077665030 11:4100360-4100382 GCTTGGGCCCAGAAGTGTTTCGG + Intronic
1078078902 11:8189191-8189213 GCTTGGGACCAGAGGTGTTTTGG - Intergenic
1078533926 11:12158217-12158239 GCTTGGGACCAGAAGTGTTTTGG - Intronic
1078765384 11:14291838-14291860 GCATGGGACCAGAAGTGTTTGGG + Intronic
1079069959 11:17336031-17336053 GCTTGGGACCTGAAGTGTTTTGG + Intronic
1080357082 11:31461786-31461808 GCTTGGGACCAGAAGTGTTATGG - Intronic
1080522999 11:33084208-33084230 ACTTGGGACCAGAAGTGTTCAGG - Intronic
1081058473 11:38441409-38441431 GCTTGGAACCAGAAATGTTTTGG - Intergenic
1081254481 11:40875600-40875622 GCTTGAGACCAGAAGTGTATTGG - Intronic
1081443161 11:43101929-43101951 GCTTGGGACCAGAAGTGTTTGGG + Intergenic
1081552144 11:44123548-44123570 GCTCAGGACCAGAAGTGTTTTGG + Intronic
1081628297 11:44669042-44669064 ACTAGGGACCAGCAGTGCCTGGG + Intergenic
1081748568 11:45490148-45490170 GCTTGGGACCAGACGTGTCTCGG + Intergenic
1082103477 11:48193985-48194007 GCTAGAGACAAGTAGTTATTAGG - Intergenic
1082881776 11:58045165-58045187 GCTTGGGACCAGAAGTGTTTTGG - Intronic
1084114552 11:67034460-67034482 GCTTGGGACCAGAAGTGTTTTGG - Intronic
1085210435 11:74771996-74772018 GTTGGGGACCATCAGTGTTTCGG - Intronic
1085610542 11:77944872-77944894 GCTTGAGACCAGAAGTGTTTTGG - Intronic
1086334832 11:85789956-85789978 GCTTGGGATCAGAACTGTTTGGG + Intronic
1086725305 11:90175096-90175118 GCTTGGGACCAGAAATATTTTGG - Intronic
1087490706 11:98823573-98823595 GGTTGGGACCAGAAGTATTTTGG - Intergenic
1088084606 11:105961550-105961572 TTTTGGGACCAGAAGTGTTTTGG + Intronic
1088344009 11:108802158-108802180 GCATGGGACCAGAAGTGCTTTGG + Intronic
1088398363 11:109393947-109393969 GCTTAGGACTAGAAGTGTTTCGG + Intergenic
1089072741 11:115713130-115713152 GCTTGGGATCAGAAGTGTTTTGG + Intergenic
1090891592 11:130928285-130928307 GCTTGAGACCAGAAGTGCTTCGG - Intergenic
1091256496 11:134191764-134191786 GCTTGGGACCAGAAGTGTTTTGG + Intronic
1091425615 12:386174-386196 GCTTGGAACCAGAAGTGTTTTGG + Intronic
1091491240 12:934583-934605 CTTTGGGACCAGAAGTGTTTTGG - Intronic
1092119819 12:6036126-6036148 GCTTGGGACCACAACTGTTTTGG - Intronic
1092203052 12:6598901-6598923 GCTTGGGACCAGAAGTATTTTGG + Intronic
1092259444 12:6944877-6944899 GGTTGGGACCGGAAGTGTTTCGG + Intronic
1092770692 12:11893905-11893927 GCTTGGGACCAGAAGTGTTCTGG - Exonic
1092873526 12:12828444-12828466 GCTTGGGACCAGCAGTGTTTCGG - Intronic
1093079809 12:14796715-14796737 GCTTGGGACCAGAAGTGTTTTGG - Intronic
1093185117 12:16011326-16011348 GCTTGGAACCAGAAGTGTTTTGG + Intronic
1093919783 12:24846791-24846813 GCTTGGGACCAGATGTGTTTTGG - Intronic
1094173202 12:27516155-27516177 GCTTGGGACCAGAAGTGTTTAGG + Intergenic
1094285557 12:28789309-28789331 TCTTGGGACCAGAATTGTTTTGG - Intergenic
1094694435 12:32803646-32803668 GCTTGAGACCAGAAGTGTTTTGG + Intronic
1095728991 12:45484683-45484705 GCTTGAGACCAGAAATGTTTCGG - Intergenic
1095729094 12:45486216-45486238 GCTTGAGATCAGAAGTGTTTTGG - Intergenic
1095892801 12:47250248-47250270 GAGAGGGACCAGTAGTGGGTGGG - Intergenic
1096236470 12:49931209-49931231 GCTTGGGACCAGAAATGTTTTGG + Intergenic
1096350787 12:50898881-50898903 GCTTGGGACCAGAAGTGTTTTGG - Intergenic
1096662981 12:53140562-53140584 GCTTGGGACCAGAAGTGTTTTGG + Intergenic
1097292182 12:57926808-57926830 GCTTGGGACTAGAAGTGTTTTGG + Intergenic
1097921938 12:65085211-65085233 GCTTGGGACCAGAAGTGTTTTGG + Intronic
1098118816 12:67212450-67212472 GTGTGTGACCAGTAGTGTTTCGG - Intergenic
1098349113 12:69539041-69539063 GCTTGGGATCAGATGTGTTTTGG + Intronic
1098544627 12:71698095-71698117 GCTTGAGACCAGAAGTGTTTTGG - Intronic
1098724545 12:73946323-73946345 GCTTGGGACCAAAAGTGTTTTGG + Intergenic
1098864008 12:75741579-75741601 GCTTGGGAGCAGAAGTGTTTAGG - Intergenic
1098966873 12:76799831-76799853 GCCTGGGACCAGAAGTGTTTTGG + Intronic
1099312163 12:81040374-81040396 GCTTGGGACAATAAGTGTTTTGG + Intronic
1099364517 12:81751646-81751668 CCTTGGGACCAGTTATGTTTTGG - Intronic
1100340470 12:93674726-93674748 GCTTGGGACCAGAAGTGTTTTGG + Intergenic
1100511496 12:95279118-95279140 GCTTGAGACTAGAAGTGTTTTGG + Intronic
1100687124 12:96998604-96998626 GCTTGGGACCAGAAGTGTTTTGG + Intergenic
1100689972 12:97029344-97029366 GCTTAGCACCAGAAGTGTTTCGG - Intergenic
1100993825 12:100280817-100280839 GCTTGGGACCAGAAGTGTTTTGG - Intronic
1101493114 12:105228215-105228237 GCTTGGGACCAGAAGGATTTAGG + Intronic
1101621129 12:106389571-106389593 GCTTGGGACCAGCAGTGTTTAGG + Intronic
1101669174 12:106850980-106851002 GCTTGGGACCAGAAGTGCTTCGG - Intronic
1102185955 12:110949318-110949340 ACTTTGGACCAGAAGTGTTTGGG + Intergenic
1102360209 12:112279779-112279801 GCCTGGGACCAGAAGTGTTTTGG + Intronic
1102378381 12:112442291-112442313 GCTTGGGACCAGAAGTGTTTTGG + Intronic
1102441779 12:112969242-112969264 GCTTGGGACCAGAAGTGTTTTGG - Intronic
1102800214 12:115725796-115725818 GCTTGGGACCAGAAGTGTTTTGG + Intergenic
1102845747 12:116180542-116180564 GCTTGGGACCAGAAGTGTTTGGG - Intronic
1102851983 12:116255973-116255995 GCTTGGAACCACAAGTGTTTTGG - Intronic
1103121123 12:118380459-118380481 GCTTGGGATCAGAAGTGTTTTGG - Intronic
1105057480 12:133115805-133115827 ACTTGGGACCAGAACTGTTTTGG + Exonic
1105464200 13:20622057-20622079 GCTTGGGACCAGAAGTGTTTTGG + Intronic
1105959861 13:25322728-25322750 GCTTGGGACCAGAAGTGTTTTGG - Intronic
1106150629 13:27097828-27097850 GCTTGGGACCAGCAGTGGTTGGG + Intronic
1106158587 13:27180282-27180304 GCTTGGGACCAGGAGTGTCCTGG + Intergenic
1106703650 13:32257130-32257152 GCTTGGGACCAGAAGTGTTTTGG - Intronic
1106705374 13:32274020-32274042 GCTTGGGACCAGAAGGGTTTCGG - Intronic
1106728264 13:32509355-32509377 GCTTGAGACCAGAAGTGTTTTGG - Intronic
1108002533 13:45917368-45917390 GCTTGGAACCAGAAGTGTTTTGG + Intergenic
1108008887 13:45982627-45982649 GCTTGGGACCACAGGTGTTTTGG + Intronic
1108085406 13:46784835-46784857 CCTTTGGACCAGGAGTGTTTGGG + Intronic
1108226303 13:48293354-48293376 AATAGGGACCAGTGGAGTTTGGG - Intergenic
1108901764 13:55419124-55419146 GCTTAAGACCAGAAGTGTTTTGG - Intergenic
1110022834 13:70497549-70497571 GTTTGGCACCAGAAGTGTTTTGG - Intergenic
1110446725 13:75591830-75591852 GCTTGGGATGAGAAGTGTTTTGG + Intronic
1110544665 13:76743332-76743354 ACTTGAGACCAGAAGTGTTTTGG - Intergenic
1110588879 13:77230469-77230491 GCTTGGGACCAGAAGTGTTTTGG + Intronic
1110782820 13:79486172-79486194 GCTTGGGACCAGAAGTGTTTTGG - Intronic
1111533398 13:89570491-89570513 GCTTGGAAACAGAAGTGTTTTGG - Intergenic
1111715191 13:91870889-91870911 GCTTGGTACCAGAAGTGATTAGG + Intronic
1111922038 13:94422379-94422401 GGTTGGGACAAGAAGTGTTTCGG + Intergenic
1111924070 13:94444273-94444295 GCTTGGGACCAGAAGTGTTTGGG - Intronic
1112273313 13:97991505-97991527 GCTTGGGAGTAGAAGTGTTTCGG + Intronic
1112637376 13:101230204-101230226 GCTTGGGAACAGAAGTGTTTTGG - Intronic
1112705134 13:102060179-102060201 GCCTGGGACCAGAAATGTTTAGG - Intronic
1113359224 13:109613367-109613389 GCTTGGGACCAGAAGTGCTTTGG + Intergenic
1113446197 13:110369448-110369470 GCTTGGGACCAGAAGTGTTTTGG - Intronic
1113529615 13:111012812-111012834 GCTAGGCACCACTAGTGACTGGG - Intergenic
1113746421 13:112748185-112748207 GCTTGGGACCAGATGTGCTTTGG - Intronic
1113978930 13:114255612-114255634 GCTTGAGACCAGAAGTGTCTGGG - Intronic
1113986065 13:114316729-114316751 GCTTGGAACCAGAAGTGCTTTGG + Intronic
1114071563 14:19113209-19113231 GCGTGGGACCAGAAGTATTTTGG + Intergenic
1114090698 14:19286759-19286781 GCGTGGGACCAGAAGTATTTTGG - Intergenic
1115187273 14:30703855-30703877 GCTTGGAACCAGAAGTGTTTTGG + Intronic
1115229043 14:31138186-31138208 GCTTGGAACCAGAAGTGTTTTGG - Intronic
1115286984 14:31725405-31725427 GCTGCGTACCAGAAGTGTTTTGG + Intronic
1115981925 14:39062237-39062259 GCTTGGGACCCGAAATGTTTTGG + Intronic
1116340698 14:43719801-43719823 GCTTGGGAGCAGAAATGTTTTGG + Intergenic
1116399746 14:44491852-44491874 GCTTAGGACAAGAAGTGTTTTGG - Intergenic
1117148805 14:52864081-52864103 TCTTGGGACCAGAAGTATTTTGG + Intronic
1117393623 14:55286778-55286800 GCTTGGGACCAGAAGTGGTTTGG + Intronic
1117423100 14:55566956-55566978 ACTTGGGACCAGAAGTGTTTTGG + Intronic
1117586301 14:57210406-57210428 TCTTGGGACCAGAAGTGTTTTGG + Intronic
1117686240 14:58256297-58256319 GCTTGGGACCAGCAGTATATCGG + Intronic
1117696374 14:58368653-58368675 GCTTGGGTCTAGAAGTGTTTGGG + Intronic
1117862289 14:60104981-60105003 CCTTGAGACCAGAAGTGTTTTGG + Intronic
1118142386 14:63098440-63098462 GCTTGGGTTCAGAAGTGTTTTGG + Intronic
1118392886 14:65310605-65310627 GCTTGGGACCAGAAATGTTTTGG - Intergenic
1118561637 14:67090589-67090611 GCTTGGGACCAGAAGTATTTTGG - Intronic
1118587981 14:67374269-67374291 GCTTGGGACCAAAAGTGTTTTGG - Intronic
1118633929 14:67730588-67730610 GCTTGGGATCAGAAGTATTTAGG - Intronic
1118906620 14:70028064-70028086 CTTGGGGACCAGTAGAGTTTTGG + Intronic
1119055020 14:71410500-71410522 GCTTGGGACCGGAAGTGTTTAGG + Intronic
1119065554 14:71522425-71522447 GCTTGGGACCAGAAGTGTTTTGG + Intronic
1119603949 14:75998475-75998497 GCTGAGGACCACTTGTGTTTAGG + Intronic
1119610956 14:76061761-76061783 GCTTAGGACCAGAAGTGTTTCGG + Intronic
1119821474 14:77619991-77620013 GCTAAGCACCAGAAGTGGTTTGG - Intergenic
1120089249 14:80312057-80312079 GCCTGGGACCAGAAGTGTTTCGG + Intronic
1120936581 14:89901973-89901995 GCATGAGACCAGAAGTGTTTTGG - Intronic
1121025133 14:90610121-90610143 GCCCGGGACCAGAAGTGTGTTGG - Intronic
1121058817 14:90884464-90884486 GCTTGGGACCAGAAGTATTTTGG - Intronic
1121592538 14:95127399-95127421 GCTTGGGACCTGAACTGTTTTGG + Intronic
1121771323 14:96544435-96544457 GCTTGGGACCAGAAGTGTTTAGG + Intronic
1123001593 14:105298168-105298190 GCTTGGGACCAGAAGTGTTTTGG - Intronic
1202901429 14_GL000194v1_random:43665-43687 GTTTGGAACCAGAAGTGTTTAGG - Intergenic
1123954736 15:25323642-25323664 GCTAGTGAACAGCAGTGATTAGG + Intergenic
1124434819 15:29638314-29638336 GATAGAGACCAGTGGTGTTCAGG - Intergenic
1124447878 15:29754668-29754690 GCTTGGGACCAGAACTGTTTTGG + Intronic
1124936328 15:34175216-34175238 GCTTGGAAGCAGAAGTGTTTTGG + Intronic
1125562023 15:40641727-40641749 GCTTGGGACCAGAAGTGTTTTGG - Intronic
1125803633 15:42473237-42473259 GCTTGGGACCAAAAGTGTTGTGG - Intronic
1125816024 15:42585171-42585193 GCTTGGGACCAGAACTGTTTCGG - Intronic
1125828878 15:42697822-42697844 GTGTGGGACCAGAAGTGTTTTGG - Intronic
1126024932 15:44436882-44436904 GCTTGGTATCAGAAGTGTTTTGG + Intronic
1126118184 15:45227800-45227822 GCCATGGACCAGTACTGGTTAGG + Intergenic
1126136124 15:45393666-45393688 GCTTGGGACCAGAAGTGTTTTGG + Intronic
1126171682 15:45700502-45700524 GCTTGGGACCAGAAGTGTTTTGG - Intergenic
1126997449 15:54461367-54461389 GCTAGGGACCAGTAGTGTTTTGG - Intronic
1127262076 15:57333777-57333799 GCTTCAGACCAGAAGTGTTTTGG + Intergenic
1127434149 15:58939835-58939857 GCTTGGTACCAGAAATGTTTTGG + Intronic
1127512279 15:59654819-59654841 GCTTGGGACCTGAAGTCTTTTGG + Intronic
1128187850 15:65658546-65658568 GTTTCGGACCAGAAGTGTTTTGG + Intronic
1128630020 15:69255437-69255459 GCTTGGGACCAGAAGGGTTTTGG - Intronic
1129205279 15:74033663-74033685 GCAAAGGCACAGTAGTGTTTGGG - Intronic
1129978044 15:79839038-79839060 TCTTGGGACCAGAAGTGTTTTGG - Intronic
1130024257 15:80257690-80257712 GCTTGAGACCAGAAGTGTTTTGG + Intergenic
1130420313 15:83739613-83739635 GCTTGGGACCAGAACTATTTTGG - Intronic
1130525076 15:84698879-84698901 GCTTGGGGCCAGAAGTATTTTGG - Intronic
1130564841 15:84984936-84984958 GCTTGAGACCAGAAGTGTTTTGG - Intronic
1130958444 15:88643798-88643820 GCTGGGGACCAGAAGGGTTTTGG + Intronic
1131129141 15:89884014-89884036 GTTTGGGACCAGAAGTGTTTTGG - Intronic
1131204813 15:90434680-90434702 GCTTGGGACCAGAAGTGTTTTGG + Intronic
1131312263 15:91301704-91301726 GTTTGGGACCAGAAGTGTTCTGG + Intergenic
1131318388 15:91362486-91362508 CCTTGGGACAAGAAGTGTTTTGG - Intergenic
1131366148 15:91842869-91842891 GGTTGGGGCCAGAAGTGTTTTGG - Intergenic
1131381983 15:91971908-91971930 GCTTGGGACCAGAAGTGTTTTGG + Intronic
1131655137 15:94448639-94448661 GCTTGGGACCAGAAGTGTTCTGG - Intronic
1132705705 16:1242291-1242313 GGTAGGAAGCAGTGGTGTTTTGG - Exonic
1133332560 16:4984194-4984216 GCCAGGGACCAGGAGTGGTGAGG - Intronic
1134220480 16:12349632-12349654 GCTCAGGACCAGAAGTATTTTGG - Intronic
1135238715 16:20783355-20783377 GCTTGAGACCAGAAGTCTTTTGG + Intronic
1135248879 16:20883001-20883023 GCTTGAGACCAGAAGTGTTCTGG + Intronic
1135570272 16:23544025-23544047 GCTTGGGACCAGAAGTGTTTTGG - Intronic
1135864411 16:26087659-26087681 GCTTGTGACCAGAAGTGTTTTGG + Intronic
1136633772 16:31506368-31506390 GCTTGCAACCAGAAGTGTTTTGG - Intronic
1137764715 16:50968999-50969021 GCTTGGGACCAGAAATGATTTGG + Intergenic
1138523463 16:57587136-57587158 GCTTGGGACCAGCAGTGCTTTGG + Intronic
1138850680 16:60626195-60626217 GCTGGAAACCAGAAGTGTTTTGG - Intergenic
1139416874 16:66819567-66819589 GCTTGGGACCATAAGTGTTTTGG + Intronic
1139419050 16:66837514-66837536 TCTTGGGACCAGAAATGTTTTGG - Intronic
1139748284 16:69092183-69092205 GCTTGGGTCCAGTACTGGTTTGG - Intergenic
1139831606 16:69802960-69802982 GCTTGGGACTGGAAGTGTTTTGG - Intronic
1140637221 16:76929369-76929391 GCTACGGACGAATAGTGCTTTGG + Intergenic
1140685369 16:77428823-77428845 GTTTGGGACCAGAAGTGTTGTGG - Intronic
1141085197 16:81089213-81089235 GCTTGGGAGCAGAAGTGTTTTGG + Intronic
1142111509 16:88334337-88334359 GCTCGGGACCAGAAGTGTTTTGG + Intergenic
1142521530 17:508194-508216 GCTTGGGCCCAGGAGTGTTTTGG - Intergenic
1142702476 17:1672058-1672080 GCTTGGGACCAGAAATGTTTTGG - Intronic
1142822081 17:2477370-2477392 GCTTGGGATGAGAAGTGTTTTGG + Intronic
1142844802 17:2664715-2664737 GCTCGGGACCAAAAATGTTTTGG - Intronic
1143120243 17:4602051-4602073 GCCTGGGACCAGAAGTGTTTTGG + Intronic
1143235390 17:5395294-5395316 GCTTGGGATCAGAAGTGTTTTGG + Intronic
1143275760 17:5708784-5708806 GCTTAGGACCAGAAATGTTTTGG + Intergenic
1144198345 17:12917059-12917081 GCTTGGGACCAGAAATATTTGGG - Intronic
1146234909 17:31150106-31150128 GCTTGGGACCAGAAGTGTTTTGG + Intronic
1146339120 17:32004997-32005019 GCTTTGGATCAGAAGTGTTTTGG - Intergenic
1148036387 17:44664616-44664638 GCTTGGGATCAGAGGTGTTTTGG - Intronic
1148256599 17:46138598-46138620 GTTTGGGACCAGAGGTGTTTTGG - Intronic
1148263203 17:46202329-46202351 GCTTGGGACCAGAAGTTTTTTGG - Intronic
1148524306 17:48315937-48315959 GCTTGGGACCAGATGGGTTTTGG - Intronic
1148665827 17:49374073-49374095 GCTTGGAACCAGAAGTGCTTTGG - Intronic
1149356078 17:55840927-55840949 TCTTGGGACCAGAAGTGTTTAGG - Intronic
1149508963 17:57221395-57221417 GCTTGGGAACAGAAGTGTTTTGG - Intergenic
1150045259 17:61906307-61906329 GCTTGAGACCAGAAGCGTTTGGG - Intronic
1150422714 17:65053153-65053175 GCCTGGGACCAGAAGTGTTTTGG + Intronic
1150880059 17:69014452-69014474 GTTTGGGACCAGAAGTGTTTCGG - Intronic
1151138962 17:71973698-71973720 GCTTGGGACCAGAAGTGTTTTGG - Intergenic
1152079451 17:78177487-78177509 GCCTGGGACCAGAAGTGTTTCGG - Intronic
1152443051 17:80321062-80321084 GCTTGAGACCAGAAGTGTTTTGG + Intronic
1152517697 17:80835806-80835828 GCCTGGGACCGGAAGTGTTTTGG - Intronic
1153197493 18:2616741-2616763 GCTTGGGACCAGAATTGTTTTGG + Intergenic
1153214233 18:2803823-2803845 GGTTGGGACCTGAAGTGTTTTGG + Exonic
1153782006 18:8502898-8502920 GCTTGGGACAAAAAGTGTTTTGG + Intergenic
1153874532 18:9356818-9356840 GCTGGGTACCAAAAGTGTTTTGG - Intronic
1154275832 18:12959280-12959302 GCTAGGATCCAGAAATGTTTTGG + Intronic
1154350728 18:13580989-13581011 GCTTGGGACCAGAAGTGTTTTGG + Intronic
1154470120 18:14692783-14692805 GCTTGGGAGCAGCAGTGTTGGGG + Intergenic
1155238526 18:23844717-23844739 GATTGGGACCAGCAGTGTTTTGG + Intronic
1155461578 18:26090368-26090390 GCTGGGAATCAGCAGTGTTTGGG - Intronic
1155585804 18:27363087-27363109 TCTTGAGACCAGAAGTGTTTTGG + Intergenic
1156104170 18:33636768-33636790 GTTTGGGACCAGAAGTGTCTTGG + Intronic
1156965465 18:43086077-43086099 GCTTGGGACCAGAAATGTTTTGG + Intronic
1157321026 18:46634674-46634696 GCTTGGGACCAGAAGTGTTTTGG - Intronic
1157879055 18:51302191-51302213 ACTTGGGACCTGAAGTGTTTTGG + Intergenic
1158140962 18:54255179-54255201 TCTTGGGACCAGGAATGTTTGGG + Intergenic
1158254829 18:55533954-55533976 GCTTAGGATCAGAAGTGTTTTGG + Intronic
1158452847 18:57582387-57582409 GCTTGGGACCAGAGGTGTTTTGG - Intronic
1158585487 18:58729748-58729770 GTTTGGGACCAGGAGTGTTTTGG - Intronic
1159439937 18:68465367-68465389 GCTTGGGACCAGGAGTGCTTTGG - Intergenic
1159624338 18:70674634-70674656 GCTTGGGACCAGAAGTGTTTTGG + Intergenic
1159976366 18:74717722-74717744 GCTTTGGACCAGATGTGTTTTGG + Intronic
1160550922 18:79693485-79693507 GCTTGGAAACAGAAGTGTTTTGG + Intronic
1161773996 19:6247698-6247720 GCTTGGGATCAGAAATGTTTTGG + Intronic
1161907384 19:7166951-7166973 GCTTGGGACCAGAAGTGTTTTGG + Intronic
1162508832 19:11104883-11104905 GCTTGGGACCAGAAGTGTTTTGG - Intronic
1163265640 19:16219275-16219297 GCTTGGGAGCAGAAGTGTTTTGG + Intronic
1164746773 19:30622326-30622348 TCTATGAACCAGCAGTGTTTAGG + Intronic
1164920886 19:32087794-32087816 GCTTGGGACCAGAAGCATTTTGG + Intergenic
1164979198 19:32600655-32600677 GCTTGGGACCAGCAGTGTTTTGG - Intronic
1165162328 19:33824185-33824207 GCTCGGGACCAGAAGTGTTTTGG + Intergenic
1165582630 19:36881301-36881323 GCTTGGGACCAGAAGTGTTTTGG - Intronic
1166276856 19:41760030-41760052 GCTTAGGACCAAAAGTGTTTTGG - Intronic
1167244267 19:48364375-48364397 GCTAGGGACCAGGAGGGGTGGGG + Exonic
1168053108 19:53844878-53844900 GCTTGGGGCCAGAAGCGTTTCGG + Intergenic
1168496925 19:56860814-56860836 GCTTGACACCAGAAGTGTTTTGG - Intergenic
1168512332 19:56982791-56982813 GCTCAGGGCCAGGAGTGTTTTGG - Intergenic
1202695733 1_KI270712v1_random:124246-124268 GCTTGGGACCAGAAGTGTTTTGG - Intergenic
925026800 2:615233-615255 GCTTGGGACCAGAAGTATTTTGG + Intergenic
925108860 2:1316575-1316597 GCTTGAGACCAGAAGTGTTTGGG + Intronic
925634060 2:5925483-5925505 GCTTGGGACCAGAAGTGTTTTGG - Intergenic
925707049 2:6695871-6695893 GCTTGGGACCGGAAGTGTTTTGG + Intergenic
925813868 2:7728155-7728177 GCTTGGGGCCAGAAGTGTTTTGG - Intergenic
926576372 2:14586659-14586681 GCTTGAAACCAGAAGTGTTTTGG + Intergenic
927764186 2:25789770-25789792 GCTTGGAACCAGAAGTGTTTTGG - Intronic
928393916 2:30929735-30929757 GCTTGGAATCAGAAGTGTTTTGG + Intronic
928522905 2:32107692-32107714 GCTTGGGACCAGAACTGCTTAGG - Intronic
928581195 2:32709402-32709424 GCTTGGGACCAGAAATGTTTTGG + Intronic
928769120 2:34684774-34684796 GCTTAGGACCAGAAGTATTTGGG + Intergenic
928957971 2:36890976-36890998 GCTTGGGACTAGAAGTATTTCGG + Intronic
929177405 2:38994561-38994583 GCTTGGGACCAAAAGTGTTCTGG + Intronic
929986365 2:46736812-46736834 GCTTGGGACCAGAAGTGTTTTGG + Intronic
930193254 2:48482069-48482091 GCTTAGGACCAGCAGTGTTTTGG - Intronic
930645840 2:53905845-53905867 GCTCAGGACCAGAAATGTTTTGG + Intronic
930779345 2:55208179-55208201 GCGTGGGACCAGAAGTGTTTTGG + Intronic
931006988 2:57861780-57861802 GCTTGGGACCAGAAGTGTTTTGG + Intergenic
931613187 2:64126004-64126026 CCTTGGGACCGGAAGTGTTTTGG - Intronic
931994695 2:67828837-67828859 ACTTGGGACCAGAAGTGTTTTGG - Intergenic
933904922 2:86882487-86882509 ACTTGGGACCATAAGTGTTTTGG - Intergenic
934276895 2:91581288-91581310 GCTTGGGACCAGAAGTGTTTTGG - Intergenic
936069928 2:109360582-109360604 GCTTGAGACCAAAAGTGTTTTGG - Intronic
936097571 2:109543827-109543849 GCTAGGGACCAGAAGTGTTTTGG + Exonic
936699821 2:114997797-114997819 CCTTAGGACCAGAAGTGTTTAGG + Intronic
936708539 2:115103872-115103894 GCTTAGGACCAGAAGTGTTTTGG + Intronic
937330970 2:121029483-121029505 GCTTGGGACCAGAAGCGTTTTGG + Intergenic
937621083 2:123986965-123986987 GCTTGGAACCAAAAGTGTTTTGG + Intergenic
937946671 2:127344810-127344832 GTTTGGGACCAGAAGTTTTTTGG - Intronic
938485697 2:131705453-131705475 GCATGGGACCAGAAGTATTTTGG + Intergenic
938510803 2:131941178-131941200 GCTAAGGAACAGAAGTGTTTTGG - Intergenic
938817148 2:134916603-134916625 GCTTGAGACCAGATGTGTTTTGG - Intergenic
938909614 2:135874773-135874795 GCTTGGGACCAGAAGAGTTTGGG - Intronic
938919113 2:135976811-135976833 GCTTGGGACTGGAAGTGTTTTGG - Intronic
939140452 2:138347720-138347742 GCTAGGGACCAGAAGTGTTTTGG + Intergenic
939147555 2:138434335-138434357 ACTAGGCACCAGTAGTGCTGTGG + Intergenic
939499408 2:142963834-142963856 ACTTGGGACCAGAAGTATTTTGG + Intronic
939901981 2:147861702-147861724 GCTTAGGATCAGAAGTGTTTTGG - Intronic
939978463 2:148748541-148748563 GTTTGGGACCAGAAGTGTTTTGG + Intronic
940232386 2:151470413-151470435 GCTTAGGACCAGAAATGTTTTGG + Intronic
940824250 2:158392566-158392588 GCTTGGGACCAGAAGTGTTCTGG - Intronic
941426525 2:165352834-165352856 GCTTGGGGCCAGAAGTGTTTTGG - Intronic
941929441 2:170925499-170925521 GCTTGAGACCAGAAGTGTTTTGG - Intergenic
942086007 2:172444621-172444643 GCTTGGGACTACAAGTGTTTTGG - Intronic
942113901 2:172708637-172708659 GCTTGGGATCAGAAGTGTTTTGG + Intergenic
942262945 2:174188908-174188930 GCTTGGGGCCAGAAGTGTTTTGG - Intronic
942441339 2:176040046-176040068 ACTTGGGAACAGAAGTGTTTTGG + Intergenic
942543930 2:177043431-177043453 GCTTGGGGCCAGAAGTGTTTTGG - Intergenic
943633862 2:190283607-190283629 GCTTAGGACGAGGAGTGTTTTGG - Intronic
943648006 2:190428495-190428517 GCTTGGGACCAGGAGTATTTTGG + Intronic
944117293 2:196202806-196202828 GCTTGGCACCAGAAGTGCTTTGG + Intronic
944644216 2:201762458-201762480 GCTTGGGACCAGAGGTGTTTTGG + Intronic
945312316 2:208328555-208328577 GCTTGGGACCAGAAGTGTTTTGG + Intronic
945829158 2:214762333-214762355 GCTTGGGATCAGAAGTATTTGGG - Intronic
945952513 2:216053196-216053218 GCTTGGAACCAGAAGTGCTTTGG + Intronic
946370010 2:219275187-219275209 GCTTGGGAACAGAAGTGTTTAGG + Intronic
946699278 2:222395157-222395179 GCTTAGGACCAGAAGTATTTTGG - Intergenic
946710719 2:222502404-222502426 GTTTGGGACCAGAAGTGTTTTGG + Intronic
948382684 2:237561732-237561754 ACTTGGGACCAGAACTGTTTTGG + Intergenic
948620878 2:239233484-239233506 GCTTGGAAGCAGAAGTGTTTTGG - Intronic
948639743 2:239368088-239368110 GCTTGGGACCAGAAGTGTTCAGG - Intronic
1169059111 20:2648187-2648209 GCTTGCAACCAGAAGTGTTTTGG + Intergenic
1169348337 20:4847738-4847760 GCGTGGGACCAGAAGTGTTTTGG + Intergenic
1169478758 20:5957692-5957714 GCCTGGGACCAGAAGTATTTTGG - Intronic
1169727585 20:8752886-8752908 GCTACAGACCAGTACTGGTTGGG - Intronic
1169793412 20:9436222-9436244 GCTTGAGACCAGAAATGTTTTGG - Intronic
1170227180 20:14004035-14004057 GCACAGGACCAGAAGTGTTTGGG + Intronic
1170232310 20:14063715-14063737 GCTTGGGACCAGAAATGTTTCGG - Intronic
1170653671 20:18266110-18266132 GCATGGGACCAGAAGTGCTTTGG + Intergenic
1170700329 20:18697464-18697486 GCTTGGGATCAGAAGTGTTTTGG + Intronic
1171394225 20:24820958-24820980 GCTTGGGACCAGGAGTGTTTTGG - Intergenic
1172438112 20:34944614-34944636 GCTTGGGACCAGAAGTCTTTCGG + Intronic
1172732999 20:37104188-37104210 GTTTGGGAGCAGAAGTGTTTTGG + Intronic
1173587636 20:44195249-44195271 GCTTGGGACCAGAAGTGTTTCGG - Intergenic
1173699162 20:45052008-45052030 GCCTGGGACCAGAAGTGTTTTGG - Intronic
1174242448 20:49148461-49148483 GCTTGCGACTAGAAGTGTTTTGG - Intronic
1174413472 20:50351482-50351504 GCTTAGGACCAGAAGTCTTTTGG - Intergenic
1174891385 20:54398924-54398946 GCTTGGGCCTAGAAGTGTTTTGG - Intergenic
1174891914 20:54404410-54404432 GTTTGGGACCAGAAGTGTTTCGG + Intergenic
1175397046 20:58672517-58672539 GCTTGAGACTAGAAGTGTTTTGG - Intronic
1175537868 20:59727846-59727868 ACTTGGGACCAGAAGTGTTTCGG - Intronic
1176620804 21:9058443-9058465 GTTTGGAACCAGAAGTGTTTAGG - Intergenic
1176783028 21:13222123-13222145 GCTAAGGAACGGAAGTGTTTTGG + Intergenic
1176979536 21:15364904-15364926 GCTTAGGACCAGAAATGTTTTGG + Intergenic
1177011663 21:15737801-15737823 GCTTGGGACCAGAAGTGTTTTGG + Intronic
1177045260 21:16160938-16160960 ACTAGGGACCAGCAGTGTTTTGG + Intergenic
1177593071 21:23198399-23198421 GCTTTAGACCAGAAGTGTTTTGG - Intergenic
1177841843 21:26243468-26243490 GCATGGGATCAGAAGTGTTTTGG + Intergenic
1177852532 21:26365757-26365779 GCTTGGGATCAGAAGTCTTTTGG - Intergenic
1177980668 21:27910929-27910951 GCTAAGGAACAGAAGTGTTTTGG + Intergenic
1178054387 21:28783042-28783064 GCTTGGGAACAGAAGTATTTTGG + Intergenic
1178463247 21:32822470-32822492 ATTTGGGACCAGAAGTGTTTTGG + Intergenic
1178554328 21:33574701-33574723 GCTTGGGACCAGAAGTGTGTCGG - Intronic
1178611893 21:34089945-34089967 GCTTGGGACCAGAAGTGTTTTGG + Intronic
1178853343 21:36231219-36231241 GCTAGGGACCAAATGTATTTTGG + Intronic
1178963690 21:37093494-37093516 GCTTGGGATCAGAAGTGTTTTGG - Intronic
1178979781 21:37253907-37253929 GCTTGGGACTAGAGGTGTTTTGG - Intronic
1179144461 21:38755170-38755192 GCTTGGGGCCAGAAGTGTTTTGG + Intergenic
1179520417 21:41940134-41940156 TCTTGGGGCCAGGAGTGTTTCGG - Intronic
1179770818 21:43614789-43614811 GCCCGGGACCAGAAGTGTTTTGG - Intronic
1180490007 22:15835541-15835563 GCGTGGGACCAGAAGTATTTTGG + Intergenic
1180678234 22:17603742-17603764 GTTTGGGACCAGAAGTTTTTTGG - Intronic
1180692104 22:17725733-17725755 GCTTGGGATCAGAAGTGTTTTGG + Intronic
1180708437 22:17823776-17823798 GTTTGAGACCAGAAGTGTTTTGG - Intronic
1180723182 22:17924638-17924660 GCTTGGGATCAGATGTGTTTTGG - Intronic
1180860642 22:19079316-19079338 GTTTGGGACCAGAAGTGTTTTGG - Intronic
1180972896 22:19824849-19824871 GGTAGGGACCTGTGGTGTTTGGG - Intronic
1181087507 22:20448365-20448387 GCTGGGGACCAGAAGTGTTTTGG - Intronic
1181625960 22:24122309-24122331 GCTTGGGACCAGAAGAGTTTTGG + Intronic
1181961720 22:26626577-26626599 GCTTGGGACCAGAAGTGTTTTGG + Intronic
1182241804 22:28921936-28921958 GCTTGGGACCAGAAGTGTTTCGG + Intronic
1182473655 22:30564064-30564086 GCTTGGGACCAGAAGTGTTTCGG - Intronic
1182489463 22:30661398-30661420 GCTTGGGACCAGAAATATTTTGG - Intronic
1182625924 22:31645991-31646013 GCTTGGGACTGGAAGTGTTTTGG - Intronic
1182724727 22:32435489-32435511 GCTTGGGACCAGAAGTGTTCTGG - Intronic
1183447956 22:37871935-37871957 GCTTGTGATCAGAAGTGTTTTGG - Intronic
1183510215 22:38230312-38230334 GCTAGGGGGCAGGAGGGTTTTGG - Intronic
949517097 3:4817774-4817796 TCTAGGTTCCAGGAGTGTTTAGG - Intronic
949595820 3:5546274-5546296 GCTTGGGACGAGCAGTGTTTTGG + Intergenic
949967370 3:9368975-9368997 ACTCGGGACCAGAAATGTTTTGG + Intronic
950068140 3:10130113-10130135 GCTTGGGACCAGAGGTGTTTTGG - Intergenic
950761407 3:15232053-15232075 ACTTGGGACCAGAAGTGTTTTGG + Intronic
950916701 3:16653210-16653232 GCTTGAGATCAGAAGTGTTTTGG + Intronic
951050165 3:18085091-18085113 GCTTGGGACCAGAAGTATTTTGG - Intronic
951086967 3:18523537-18523559 GCTTGGGACAAGAAGTGTTTTGG - Intergenic
951210804 3:19972289-19972311 GCTTGGAACCAGGAATGTTTTGG - Intronic
951230680 3:20175444-20175466 GCTTGGGACCAGAAGTGTTTTGG - Intronic
951633163 3:24743267-24743289 GCTTGGGACCAAAAGAGTTTTGG + Intergenic
952247624 3:31612180-31612202 GCTTGGGACTAGAAGTTTTTTGG - Intronic
952306562 3:32152027-32152049 ACTTGTGACCAGAAGTGTTTTGG + Intronic
952874090 3:37927452-37927474 GCTTGGGACCAGAAGTGTTTTGG - Intronic
952879967 3:37978344-37978366 GCTTGGTACCAGAAGTGTCTTGG + Intronic
952994860 3:38869882-38869904 GCTTGGGACCAGAAGTGTTTCGG - Intronic
953429285 3:42824154-42824176 GCTTGGCACCAGAAGTGTTTTGG - Intronic
953777398 3:45832510-45832532 CCTTGGGACTAGAAGTGTTTTGG - Intronic
954242600 3:49305645-49305667 GCCTGGGACCAGAAATGTTTCGG - Intronic
955140771 3:56267037-56267059 GCTTGGGACCAGAAGCATTTTGG + Intronic
955993415 3:64653081-64653103 GCTTGGGACCAGAAGTGTTTTGG - Intronic
956013384 3:64855535-64855557 GCTTGGGACCAGAAATGTTTTGG - Intergenic
956708437 3:72019506-72019528 GCTTGGGAGCATTACTGTTTGGG + Intergenic
956947988 3:74245553-74245575 TCTTGGGACCAGAAGTATTTTGG + Intergenic
957609669 3:82450857-82450879 GCTTGGGATCAGAAGGGTTTTGG - Intergenic
958679718 3:97312567-97312589 GATTGGGACCAGAAGTGTTTTGG - Intronic
958823113 3:98998973-98998995 GCCAGGGATCTGTAGTTTTTGGG + Intergenic
959032447 3:101315646-101315668 GCTTGGGACCAGAAGTGTTGTGG - Intronic
959153704 3:102640024-102640046 ACTTGGGACCAGAAGTGGTTTGG + Intergenic
959319881 3:104858930-104858952 TCTTGGGACCAGAAGTATTTTGG + Intergenic
959589593 3:108063285-108063307 GCCTGGGACCAGAAGTGTTTTGG - Intronic
959751414 3:109840624-109840646 GCTTGGGAACAAAAGTGTTTTGG + Intergenic
959856749 3:111167937-111167959 ACTTGGGACTAGAAGTGTTTTGG + Intronic
959983323 3:112543857-112543879 ATTAGGCAGCAGTAGTGTTTTGG + Intronic
960762338 3:121086596-121086618 GTTTGAGACCAGAAGTGTTTTGG + Intronic
960813826 3:121653002-121653024 GCTTGGGACCAGAAGTGTTTTGG + Intronic
961108604 3:124264026-124264048 GCTTGGAACCAGAAATGTTTTGG + Intronic
962248165 3:133815099-133815121 GCTTGGAACCAGAAGTGTTTTGG + Intronic
962566082 3:136661640-136661662 CTTGGGGACCAGAAGTGTTTTGG - Intronic
962745135 3:138391713-138391735 GCTTGGGGCCAGAGGTGTTTTGG - Intronic
963072604 3:141317141-141317163 GCTTGGGACCAGGGGTATTTTGG - Intergenic
963099405 3:141584808-141584830 GGTTGAGACCAGAAGTGTTTTGG + Intronic
963390572 3:144658648-144658670 GCCTGGGACAAGAAGTGTTTGGG - Intergenic
963687607 3:148456761-148456783 GCTTGGGACAAGAAGTGTTTTGG + Intergenic
963964620 3:151351997-151352019 GCTTGGGACCAGAAGGGTTTTGG + Intronic
964410671 3:156394366-156394388 GGTAGGGACCAGAAGTGGTGGGG + Intronic
964516260 3:157511730-157511752 GCTTGGGACCAGAAATGTTTTGG - Intronic
964969101 3:162538149-162538171 GCTTGGGAACAGAAGTGTTTTGG - Intergenic
965563297 3:170082532-170082554 GCTTGGAACCAGAAGTGTTTTGG - Intronic
965570679 3:170168927-170168949 CCTTGCGACCAGAAGTGTTTCGG + Intronic
966624029 3:181997592-181997614 GCTTGAGACCAGAAGTGTTTTGG + Intergenic
967277018 3:187786102-187786124 GCCTGGGACCAGAAGTGTTTCGG - Intergenic
967806495 3:193718755-193718777 GCTTGGGACCAGAAGAGTTTTGG - Intergenic
967862527 3:194162647-194162669 GCTTGGGACCAGAAGTGTTGTGG + Intergenic
968055100 3:195685265-195685287 CCTTGGGACCAGAAGTGTTTTGG + Intergenic
968100801 3:195963952-195963974 CGTTGGGACCAGAAGTGTTTTGG - Intergenic
968249898 3:197199546-197199568 ACTTGGGACCAGAAGCGTTTCGG - Intronic
968255348 3:197264811-197264833 ACTTGGGACCAGAAGCGTTTTGG - Intronic
968289759 3:197529479-197529501 GCTTGGGACCAGATGTGTTTTGG - Intronic
969033865 4:4235095-4235117 GCTTGGGACCAGAAGTGTTTTGG + Intergenic
969061314 4:4437533-4437555 GCTTGGGACCAGAAGTGTTTTGG - Intronic
970564943 4:17322874-17322896 GCTTGGGACCAGAAGTATTTTGG + Intergenic
970818416 4:20185594-20185616 GCTTGGAACCAGAAGTGTTCTGG - Intergenic
970866293 4:20762717-20762739 GCTTGGGAACAGAAGTGTCTTGG + Intronic
971229522 4:24789553-24789575 GCTTGGGACCAGAATTGTTTCGG + Intergenic
971304560 4:25468283-25468305 GCTTGAGACCAGAAGTGTTTGGG + Intergenic
971360093 4:25930070-25930092 GCTTGGGAACAGAAGTGTTTTGG + Intergenic
971764017 4:30805927-30805949 GCTTGGGACCAGAAGTGTTTTGG + Intronic
972492716 4:39603143-39603165 GCTTGGGACCAGAGGTGTTTTGG - Intronic
972553476 4:40156896-40156918 GCTTAGGACCAGAAGTGTTTTGG - Exonic
972664657 4:41152942-41152964 GCTTGGGACCAGAAGTGTTTTGG + Intronic
972665781 4:41164027-41164049 GCTTGGGATCAGTAGAGTTTCGG + Intronic
972734758 4:41829784-41829806 GCTTGGGACCAGAAGTGTTTTGG + Intergenic
973197077 4:47457157-47457179 GCATGGAACCAGAAGTGTTTTGG - Intronic
973303170 4:48613019-48613041 GCTTGGGACCAGAAGTGTTTTGG + Intronic
973812009 4:54580469-54580491 GCTTGGGACCAGAAGTGTTTTGG + Intergenic
973865224 4:55106115-55106137 GCTTGGGACCAAAAGTGGTTTGG + Intronic
974488498 4:62534169-62534191 CATGGGGACCAGTAGTGGTTGGG - Intergenic
975659234 4:76671799-76671821 GCTTGGAACCAGAAGTGTTTTGG + Intronic
976608422 4:87004569-87004591 GCTTGGGACCAGAATTGTTTTGG + Intronic
976610767 4:87028099-87028121 GCTTGGGACCTTAAGTGTTTTGG - Intronic
976710625 4:88067289-88067311 ACTTGGGATCAGAAGTGTTTTGG - Intronic
976901160 4:90178030-90178052 GCTTGAGACCAGAAATGTTTTGG - Intronic
977065894 4:92314802-92314824 GCTTGGGACTTGAAGTGTTTTGG - Intronic
977349860 4:95869341-95869363 GCTTGGGACAAAAAGTGTTTTGG - Intergenic
977506942 4:97914657-97914679 TCTTGAGACCAGAAGTGTTTTGG + Intronic
977690601 4:99904607-99904629 GCTTGGGACCAGCAGTGTTTTGG - Intronic
977701249 4:100025411-100025433 GCTTGAGACCAGAAGTGTTTTGG + Intergenic
978182275 4:105813588-105813610 GCTTGGGACCAGAAGTATTTTGG - Intronic
978222072 4:106289030-106289052 GTTTGGGACCAGAAGTGTTTCGG - Intronic
978352379 4:107833656-107833678 GCTTGGGACCAGAAGTCTTTTGG - Intronic
978698518 4:111614180-111614202 GCTTGGGACCAAAAGTGTTTTGG - Intergenic
978807327 4:112814123-112814145 GCTTGGGAGCTGTAGTCTTTGGG + Intergenic
980278442 4:130685988-130686010 GCTTGGGATCAGAAGTATTTTGG + Intergenic
980941230 4:139276864-139276886 GCTTGGGACCAGAAGTGTTTTGG + Intronic
981046950 4:140273487-140273509 GCTTTGGACCAGCAGTGTGTGGG + Intronic
981701751 4:147615147-147615169 GCTTTGGACCAGAAGTGTTCTGG + Intergenic
981775699 4:148364785-148364807 GCTCGGGACCAGAAGTGTTTTGG + Intronic
982470020 4:155776945-155776967 TCTTGAGACCAGAAGTGTTTAGG + Intronic
982714244 4:158790222-158790244 TCGAGGGATCAGAAGTGTTTCGG - Intronic
983088553 4:163476832-163476854 GCTTGAGACCAGAAGTGTTTTGG - Intergenic
983164762 4:164461378-164461400 GCTTGGGAACAGAAGTGTTTTGG - Intergenic
983563733 4:169127880-169127902 GCTTGTGACCAGAAGTGTTTCGG + Intronic
983595273 4:169459062-169459084 GCTTGGGATCAGAAGTGTTTTGG - Intronic
983595613 4:169463691-169463713 GCTTGGGGCCAGAAGTGTTTTGG + Intronic
983657180 4:170094727-170094749 GCTTGGGAACAGAAGTATTTGGG + Intergenic
983875581 4:172871135-172871157 GCTTGGGACCAGAAGTAATTAGG - Intronic
984671505 4:182494237-182494259 ACTAGGGACCAGATGTGTTTTGG + Intronic
984896481 4:184546070-184546092 GCTTGGGACCAGAAGTGTTTTGG - Intergenic
985125273 4:186687685-186687707 ACTTGGGACTAGAAGTGTTTTGG - Intronic
985248515 4:188000050-188000072 GCTTGGGACCAGAAGTATTATGG + Intronic
986211871 5:5681692-5681714 GCTTGGGACCAAAAGTGTTTAGG - Intergenic
986428396 5:7657166-7657188 GCTTGGGACCAGAAGTGTTTCGG - Intronic
986566206 5:9117397-9117419 GTTCAGGACCATTAGTGTTTTGG + Intronic
986814139 5:11390039-11390061 GCAGGGGATCAGAAGTGTTTTGG - Intronic
987062463 5:14255565-14255587 GCTGGGCACCAGAAGTGTTTTGG + Intronic
987161191 5:15144849-15144871 GCTTGGGACCAGAAGTATTTTGG + Intergenic
987324191 5:16797334-16797356 GCTTGGGACCTGAAGTGTTTTGG - Intronic
987449770 5:18068096-18068118 GCTTGGGACCAGAAGTGTTTGGG - Intergenic
988569903 5:32353950-32353972 GCTTGGGACCAGAAGTGTTTTGG + Intergenic
989050859 5:37318651-37318673 GTTTGGAACCAGAAGTGTTTTGG - Intronic
989073454 5:37536426-37536448 GCTGGGGACCAGAAGTATTTTGG + Intronic
990280102 5:54240922-54240944 GCGTGGGATCAGAAGTGTTTTGG - Intronic
990338397 5:54797664-54797686 GCTTGGGATCAGAATTGTTTGGG + Intergenic
990443102 5:55866290-55866312 GCTAGGGACCACTAGTCTAGGGG - Intronic
990588399 5:57235677-57235699 GCTTGGGACCAGAAGTGTTTTGG + Intronic
990935608 5:61145601-61145623 GCTTAGGAACAGAAGTGTTTGGG - Intronic
991483490 5:67109504-67109526 GCTTGGGACCACAAGTCTTTTGG - Intronic
992060502 5:73040196-73040218 GCTTGAGACCAGAAGTGTTTTGG + Intronic
992264238 5:75002543-75002565 GCTTGAGAACAGAAGTGTTTTGG - Intergenic
992272799 5:75083009-75083031 GCTTGGGACCAGAAGTATTTTGG + Intronic
992280048 5:75165209-75165231 GCTTGGGACAAGCAGTGTTTAGG - Intronic
992656525 5:78915649-78915671 ACTTAGGACCAGAAGTGTTTGGG + Intronic
993063158 5:83065715-83065737 GCTTGGAGCCAGGAGTGTTTTGG - Intronic
993395934 5:87388547-87388569 GCTTGAGACCAGAAGTGTTTCGG - Intronic
993683882 5:90914100-90914122 GCTTGGGACCAGAAATATTTTGG + Intronic
993928025 5:93896554-93896576 GCTTAGTACCAGAAGTGTTTTGG - Intronic
994264422 5:97698429-97698451 GCTTGGGACCAGAAGCATTTTGG - Intergenic
994367958 5:98937266-98937288 GGTTGGGACCAGAAGTGTTTAGG + Intergenic
994469159 5:100180434-100180456 GCTTGGGACTGGAAGTGTTTTGG - Intergenic
994702413 5:103152047-103152069 GCATGGGACCAGAAGTGTTTTGG + Intronic
994704026 5:103177251-103177273 GCTTGAGACCAGAAGTTTTTTGG + Intronic
994934217 5:106232767-106232789 GCTTGGGACCAGAAGTGTTTAGG + Intergenic
995194967 5:109356522-109356544 GTTTGGTACCAGAAGTGTTTGGG - Intronic
995510025 5:112899795-112899817 GCTTGGGACTAAAAGTGTTTCGG + Intronic
995729797 5:115226350-115226372 ACTTGGGTCCAGAAGTGTTTTGG - Intronic
995762415 5:115577377-115577399 GCTTGGGACCAGAAGTGTTTTGG - Intergenic
995810337 5:116099899-116099921 GCTTGGGACCAGAAGTGTTTTGG + Intronic
996390209 5:122952191-122952213 GCTTGGGACCACAAGTGTTTTGG - Intronic
996412529 5:123174062-123174084 TCTTGGGACCAGAAGAGTTTTGG + Intronic
996461214 5:123745206-123745228 GCTTGGGGCCAGAAGTATTTTGG + Intergenic
996703850 5:126477017-126477039 GCTTGGGACCAGAAGTGTTTTGG + Intronic
997575427 5:134972286-134972308 GCTTGGGAACAGAAGTGTTTTGG - Intronic
997912026 5:137884734-137884756 GCTTGGGACCAGAAGTGTTTTGG - Intronic
998089095 5:139352185-139352207 GCTTAGAACCAGAAGTGTTTTGG - Intronic
998243323 5:140470987-140471009 GCTTGGGACCAGAAGTGTTTTGG + Intronic
998485837 5:142501303-142501325 GTTTGGGAACAGAAGTGTTTTGG + Intergenic
998572143 5:143271206-143271228 GCTTGGGATCAGAAATGTTTTGG - Intergenic
998865399 5:146495186-146495208 GCTTGAGACCAGAAGTCTTTTGG + Intronic
999009096 5:148015411-148015433 GCTTGGGACGGGAAGTGTTTTGG - Intergenic
999227265 5:150036249-150036271 GCTTGATACCAGAAGTGTTTTGG + Intronic
999402974 5:151281317-151281339 GCTTGGGACCAGAAGTGTTTTGG - Intronic
1000217666 5:159178777-159178799 GCTTGGCACCAGAAGTGTTTTGG - Intronic
1000638013 5:163665714-163665736 GCTTGGGACCAGAAGTATTTTGG + Intergenic
1001197714 5:169688463-169688485 GCTTGGGACCAGAATTGTTTTGG + Intronic
1001480320 5:172084731-172084753 GCTTGGGACCAGAAGTGTTTTGG + Intronic
1001511996 5:172330034-172330056 GCTTAGGACCAGAAGTGTTGTGG + Intronic
1001584251 5:172822211-172822233 GCCTGGGACCAGAAGTGTTTTGG + Intergenic
1001606992 5:172968123-172968145 GCTTGAGACCAGAAGTGTTTTGG - Intronic
1002420228 5:179142304-179142326 GTTTGGAACCAGAAGTGTTTCGG + Intronic
1002946737 6:1768729-1768751 GCTTGGGAACAGAAATGTTTTGG - Intronic
1003090926 6:3102467-3102489 GCTTGGGATTAGAAGTGTTTTGG - Intronic
1003117731 6:3294489-3294511 GCTCGGGACCAGAAGTGTTTTGG - Intronic
1003223552 6:4184152-4184174 GCTTGGGATCAGAAGTGTTTGGG - Intergenic
1003562474 6:7193562-7193584 GCTTGGGACCAGAAGTGTTTGGG + Intronic
1003587421 6:7405422-7405444 GCTTGGGACCAGAAGTGTTTTGG + Intronic
1003603475 6:7540061-7540083 GCTTGGGACCAGAAATATTTTGG - Intergenic
1004052583 6:12100926-12100948 GCTTGGGACCAGAAATGTTTTGG - Intronic
1004364951 6:15004290-15004312 GCTTGGGACCAGAAGTATTTCGG + Intergenic
1004649076 6:17591135-17591157 GCTTGGGACTAGAAGTGTTACGG - Intergenic
1004689613 6:17982019-17982041 GCTTGGGACCAGAAGTGTTTTGG + Intronic
1004711246 6:18172591-18172613 GCTTGGGACCAGAAGTGTTTTGG - Intronic
1004737279 6:18420128-18420150 GCTTGGGACCAGTAGTGTTTCGG + Intronic
1004758940 6:18644492-18644514 GCTTGGGACCCGAGGTGTTTGGG + Intergenic
1004792386 6:19041291-19041313 GCTTGGGACCAGAAGTGTTTTGG - Intergenic
1006263849 6:32899027-32899049 GCTTGGGACCAAAAGTGTGTTGG + Intergenic
1006661954 6:35654316-35654338 GCTTGGGACAAGAAGTGTTTTGG - Intronic
1007019093 6:38501383-38501405 GCTTGGGACCAGAAGTGTTAAGG - Intronic
1007534077 6:42568796-42568818 GCTTGCCACCAGAAGTGTTTTGG + Intronic
1007544614 6:42683868-42683890 GCTTGGGACCAGAAGTGCTTTGG - Intronic
1007881152 6:45168290-45168312 GCTTGGGATCGGAAGTGTTTAGG + Intronic
1007888929 6:45267139-45267161 ACTTGGGACCAGAAGTATTTTGG - Intronic
1007904011 6:45440623-45440645 GCTTGGGACCAGAAGTGTTTCGG + Intronic
1007989185 6:46237663-46237685 GCTTGGGGCCAGAAGTGTTTTGG - Intronic
1008947721 6:57117158-57117180 GCTTGGAATCAGAAGTGTTTGGG + Intronic
1008969566 6:57351157-57351179 GCTTGGGATCAGATGTGTTTTGG + Intronic
1009158539 6:60252993-60253015 GCTTGGGATCAGATGTGTTTTGG + Intergenic
1009314776 6:62204422-62204444 GGTTGGGACCAGAAGAGTTTTGG + Intronic
1009890173 6:69671493-69671515 GCTTGGGAACAGAAGTGTTTTGG - Intergenic
1010143907 6:72643667-72643689 GCTTGTGACCAGAAGTGTTTTGG - Intronic
1010242992 6:73634325-73634347 GCTTGGAACCAGAAGTGTTTTGG + Intronic
1010761388 6:79727272-79727294 GCTTGGGACCAGAAGTGTTTTGG + Intergenic
1011052885 6:83173139-83173161 GCATGGGACTAGAAGTGTTTTGG - Intronic
1011460393 6:87597064-87597086 TCTTGGGACCAGAAGTGTTTTGG + Intronic
1011466982 6:87668352-87668374 GCTTGGAAACAGAAGTGTTTTGG + Intergenic
1011576020 6:88800204-88800226 GCTTAGGACCAGAAGTGGTTTGG + Intronic
1011672148 6:89693706-89693728 TCCTGGGACCAGAAGTGTTTTGG - Intronic
1011987698 6:93470787-93470809 GCTTGGGACCAGAAGGGTTTTGG + Intergenic
1012124773 6:95414934-95414956 GCTTGGGACCAGAAGTATTCAGG - Intergenic
1012272290 6:97228671-97228693 GCTTGGGACTAGAAGTGTTTTGG - Intronic
1012295797 6:97521622-97521644 GCTTGGGCCCAGAAGTATTTTGG - Intergenic
1012442271 6:99271641-99271663 GCTTGGGACCAGAAGTGTTTTGG - Exonic
1012837712 6:104291394-104291416 GCTTGGGACCAGAGGTGTTTTGG + Intergenic
1013165205 6:107583817-107583839 GCTTGGGACCAGAAGTGTTTGGG + Intronic
1014297135 6:119633070-119633092 GCTTGGGACCAGAACTATTTTGG + Intergenic
1014441312 6:121477101-121477123 ACTTTGGACCAGAAGTGTTTGGG - Intergenic
1014863486 6:126498883-126498905 GCTTGGGACTATAAGTGTTTTGG + Intergenic
1015143695 6:129962455-129962477 GCTTAGGACAAGAAGTGTTTTGG - Intergenic
1015228818 6:130889855-130889877 GTTAGGGACCAGAAGTGTTGCGG + Intronic
1015608382 6:134985744-134985766 GCTTGGGACCCAAAGTGTTTGGG - Intronic
1015643044 6:135357440-135357462 GCTTAGGACCAGAAGTGTTTTGG - Intronic
1015762134 6:136674919-136674941 GCTTGGGACCAGAAGTGTTTTGG - Intronic
1016449535 6:144167285-144167307 GCTTGGTACTAGAAGTGTTTTGG + Intronic
1016602192 6:145875121-145875143 TCTTGGGACCAGAAGTGTTTTGG - Intronic
1016926768 6:149358154-149358176 GCTTGGGACCAAAAATGTTTCGG + Intronic
1016937740 6:149460313-149460335 ACTTGGGAGCAGAAGTGTTTTGG - Intronic
1016975233 6:149801106-149801128 ATTTGGGACCAGAAGTGTTTTGG + Intronic
1017084144 6:150698045-150698067 GCTTGGGACCACAAGTGTTTTGG + Intronic
1017506767 6:155075581-155075603 GCATGGGACCAGAAGTGTTTTGG + Intronic
1017683312 6:156886097-156886119 GCTTGGGATCAGAAGTGTCTTGG - Intronic
1018160451 6:161036920-161036942 GCTTGGGACCAGAAGTGTTTTGG - Intronic
1018331395 6:162731663-162731685 GCTTGGGACCAGAAGTGTTTTGG - Intronic
1018448924 6:163887275-163887297 GCTTAGGACCAGAAGTGTTTGGG - Intergenic
1018642031 6:165913225-165913247 GCTTGGGACCAGAAGTGTCTAGG - Intronic
1019208922 6:170388694-170388716 ACTTAGGACCAGAAGTGTTTTGG + Intronic
1019304201 7:325122-325144 GCTTGCGACCTTTAGTGTTTGGG - Intergenic
1019388507 7:772240-772262 ACTCGGGACTAGTTGTGTTTAGG + Intronic
1019449123 7:1087342-1087364 GCTTGGGACCGGAAGAGTTTCGG + Intronic
1020346162 7:7166021-7166043 GCCTGGGACCAGAAGTATTTTGG - Intronic
1020666000 7:11044824-11044846 GCTGGGGACCAGAAGTGATTTGG + Intronic
1020908844 7:14102539-14102561 GCTTGGAACAAGAAGTGTTTTGG + Intergenic
1021971582 7:25970449-25970471 GCTTGGGGCCAGAAGTGTTTCGG - Intergenic
1022150056 7:27593307-27593329 GCTTGGGACCTGAAGCGTTTTGG - Intronic
1022150339 7:27596702-27596724 GCTTGGGACCAAAAGTGTTTTGG + Intronic
1022165023 7:27750420-27750442 GCTTGAGACCAGAAGTGCTTTGG - Intronic
1022642353 7:32200082-32200104 GCCTGGGACCAGAAATGTTTTGG - Intronic
1022917892 7:34978712-34978734 TCCTGGGACCAGAAGTGTTTTGG + Intronic
1023004933 7:35854165-35854187 GCTTGGGACCAGAAGCGTGTTGG - Intronic
1023028871 7:36075953-36075975 ACTTGGGACCAGAAGTGTTTTGG + Intergenic
1023061091 7:36327824-36327846 GCTTGGGACTAGAAGTGTTTTGG - Intronic
1023387675 7:39676425-39676447 GCCTGGGATCAGAAGTGTTTGGG + Intronic
1023630617 7:42160316-42160338 GCTTGAGACCAGAAGTCTTTCGG + Intronic
1023833410 7:44053589-44053611 GCTTAGGACCAGAAATGTTTTGG + Intronic
1023958512 7:44907454-44907476 GCTTAGGACCAGCAGTGTTTTGG + Intergenic
1024320074 7:48056694-48056716 CCTTGGGACCAGAAGTGTTTGGG - Intronic
1024492290 7:49999096-49999118 GCTTGGGACCAGAAGTGTTTTGG - Intronic
1025218440 7:57081521-57081543 GCTTGGGACCAGAAGCGTTTTGG + Intergenic
1025257040 7:57391088-57391110 GCTTAGGACCAGAAGTGTTTTGG + Intergenic
1025629359 7:63255140-63255162 GCTTGGGACCAGAAGCGTTTTGG + Intergenic
1025652908 7:63488940-63488962 GCTTGGGACCAGAAGCGTTTTGG - Intergenic
1025842559 7:65164165-65164187 GCTTGAGACCAGAAGTGTTTTGG + Intergenic
1025880486 7:65531803-65531825 GCTTGAGACCAGAAGTGTTTTGG - Intergenic
1025892951 7:65670801-65670823 GCTTGAGACCAGAAGTGTTTTGG + Intergenic
1025998194 7:66541768-66541790 GCCAGGGACCTGCAGGGTTTGGG + Intergenic
1026131432 7:67624155-67624177 GCTTGGGTCCAGAAGTGTTTTGG + Intergenic
1026270746 7:68834569-68834591 GCTTGGGACAAAAAGTGTTTTGG - Intergenic
1026270930 7:68836241-68836263 TCATGGGACCAGAAGTGTTTTGG - Intergenic
1026427002 7:70304686-70304708 ACTTGAGACCAGAAGTGTTTTGG + Intronic
1026991148 7:74586564-74586586 GCCAGGGACCTGCAGGGTTTGGG + Intronic
1027912354 7:84267232-84267254 GCTTGGGACTAGAAGTGTTTTGG - Intronic
1028163115 7:87508419-87508441 ACTTGGGACCAGAAGTGTTTTGG - Intronic
1028229877 7:88294418-88294440 GCTTGGGACCAGAAATGTTTTGG - Intronic
1028282430 7:88947781-88947803 GCTTGGGACCAGAATTGTTTGGG - Intronic
1028741715 7:94283008-94283030 GCTTGGGACCAGGAGTGTTTGGG - Intergenic
1029288315 7:99481983-99482005 GCTGGGGACCAAAAGTGTTTTGG + Intronic
1029837957 7:103332967-103332989 GCTTGGGACCAAAAGTGTTCGGG + Intronic
1029912379 7:104167295-104167317 GCTTGGGACCAGAAGTGTTTTGG + Intronic
1030075238 7:105731286-105731308 GCTTGGGACCAGAAGTGTTTTGG - Intronic
1030721745 7:112879589-112879611 GCTTAGGACCAGAAGTGTTTTGG + Intronic
1031047522 7:116908969-116908991 GCTTGGGACCAGAAGTCTTTTGG + Intronic
1031067243 7:117118282-117118304 GCTTGGAACCAGAAATGTTTTGG - Intronic
1031405161 7:121376488-121376510 GCTTAGGACCAGAAGTATTTTGG + Intronic
1031442010 7:121806258-121806280 ACTCAGGACCAGAAGTGTTTTGG - Intergenic
1031858052 7:126945690-126945712 GCCTGGGACCAGAAGTGCTTTGG - Intronic
1031936160 7:127737658-127737680 GGTTGGGACCAGAAGTGATTCGG + Intronic
1031937494 7:127750575-127750597 GCTTGGGACCAGAAGTGTTTTGG + Intronic
1032104288 7:129012617-129012639 GCTTGGGACCAGAAGGGTTTAGG - Intronic
1032175274 7:129618744-129618766 GCTTAGGACCAGAAATGTTTTGG + Intronic
1032210810 7:129912292-129912314 GCATGGGACCAGAAATGTTTTGG + Intronic
1032241902 7:130168416-130168438 GCTTGGAACCAGGAGTGTTTCGG - Intronic
1032298589 7:130666623-130666645 GCTCGGAACCAGAAGTGTTTTGG - Intronic
1032350920 7:131162688-131162710 GCTTGGGACCACAAGTATTTCGG - Intronic
1032620991 7:133531876-133531898 GCTTTGGACCAGAAGCGTTTGGG + Intronic
1032638217 7:133734796-133734818 GCTTGGGATCAGAAGTGTTTTGG - Intronic
1032809616 7:135398589-135398611 TCTTGGGAACAGAAGTGTTTTGG - Intronic
1032885963 7:136138662-136138684 GCTTGGGACCAGACATGTTTTGG - Intergenic
1033205025 7:139412255-139412277 GCTAAGGATCATAAGTGTTTCGG - Intronic
1033734315 7:144207065-144207087 GCTTGGGACCAGAAGTGTTTTGG - Intergenic
1033748736 7:144343904-144343926 GCTTGGGACCAGAAGTGTTTTGG + Intergenic
1034465299 7:151224556-151224578 GCTTGGAACCAGAAGTGTTTCGG - Intronic
1034606436 7:152320224-152320246 GTTTGGGACCAGATGTGTTTTGG - Intronic
1035744848 8:1954485-1954507 TCTTGGGACCACAAGTGTTTTGG - Intronic
1036705321 8:11042206-11042228 GCTTGGGACCAGAAGTGTTTAGG + Intronic
1037401387 8:18498422-18498444 GCTTGGGACCAGAAGTGTTTTGG - Intergenic
1037711756 8:21360714-21360736 GCTAGAAAGCAGTAATGTTTTGG - Intergenic
1038118076 8:24580339-24580361 GCTTGAGACCAGAAGTGTTTTGG - Intergenic
1038179581 8:25213900-25213922 ACTTGAGACCAGAAGTGTTTTGG + Intronic
1038430913 8:27498750-27498772 GAAAGGGACCAGGAGTCTTTTGG + Intronic
1038508713 8:28109542-28109564 GCCTGGGACCAGAAGTGTTTCGG + Intronic
1038519008 8:28213331-28213353 GCTTGGGACCAGAAGTTTTTTGG + Intergenic
1038886530 8:31668896-31668918 TCTTAGGACCAGAAGTGTTTTGG + Intronic
1038973147 8:32660261-32660283 GCTTAGGGCCAGAAGTGTTTTGG - Intronic
1039117541 8:34108974-34108996 GCTTGGGACCAGAAGCGTTTTGG - Intergenic
1039915377 8:41856784-41856806 GCTTGGGACCAGAAATGTTTTGG - Intronic
1039928886 8:41964655-41964677 GCTTGGGACCAGAAGTGTTTTGG - Intronic
1040469174 8:47722737-47722759 GCTTGGAACCAGAAATGTTTTGG + Intronic
1040486635 8:47878947-47878969 GCTTGGAACCAGAAGTGTTTCGG - Intronic
1040765586 8:50906181-50906203 GCTTGGGACCAGAAGTGTTTTGG - Intergenic
1041042130 8:53857798-53857820 GTTTGGAACCAGAAGTGTTTTGG - Intronic
1041307391 8:56476319-56476341 GCTAGGGACCAGAAGTGTTTTGG + Intergenic
1041459877 8:58099373-58099395 GTGTGGGACCAGAAGTGTTTTGG - Intronic
1041601725 8:59725826-59725848 ACTTGAGACCAGAAGTGTTTTGG - Intergenic
1041614416 8:59888665-59888687 GCTTGGAAACAGAAGTGTTTTGG - Intergenic
1041645948 8:60252853-60252875 GCTTGGGACCAGAAGTATTTTGG - Intronic
1042155172 8:65837376-65837398 GCTTGGGATCAGGAGTGTTTTGG + Intronic
1042211375 8:66384188-66384210 GCTTGGGACCAGAACTGTTCTGG + Intergenic
1042260711 8:66856422-66856444 GTTTGGGACCAGAAGTGTTTTGG + Intronic
1042300642 8:67276755-67276777 GCTTGGGACCAGAAGTGTTTTGG + Intronic
1042559481 8:70062350-70062372 GCTTGGGACCAGAAGTGTTTTGG + Intronic
1042559680 8:70063990-70064012 GCCTGGGACCAGAAGTGTTTTGG - Intronic
1042675328 8:71314491-71314513 GCTTGGGACCAGAAATGTTTTGG + Intronic
1042756728 8:72222621-72222643 GCTTGGGACCAGTCGTGTTTTGG - Intergenic
1042908400 8:73798449-73798471 GGTTGGGACCAGAAGTGTTTTGG - Intronic
1042911546 8:73832656-73832678 GCTTGTGACCAGAACTGTTTCGG + Intronic
1043166262 8:76906649-76906671 GCTTGGTACCAGAAGTATTTTGG - Intergenic
1043485606 8:80696387-80696409 GTTTGAGACCAGAAGTGTTTTGG + Intronic
1044100912 8:88137319-88137341 TATTGGGACCAGAAGTGTTTGGG - Intronic
1045105362 8:98887408-98887430 GCTTAGGACCAGAAGTGTTTTGG - Intronic
1045580582 8:103475375-103475397 GCTTGGGACCAGAAATGTTTTGG - Intergenic
1045668564 8:104519434-104519456 GCTTGGGACCAAAAGTGTTTTGG + Intronic
1045698131 8:104834519-104834541 GCTGCAGACCAGTAGTGGTTAGG + Intronic
1045848330 8:106663078-106663100 GCTTGGGAACAGGAGTGTTTTGG - Intronic
1045930340 8:107617728-107617750 GCTTGGAACCAGAAGTGTCTTGG - Intergenic
1046962642 8:120126332-120126354 GCTAAGGTCCAGGAGGGTTTTGG + Intronic
1046972867 8:120242191-120242213 GCTTGAGACCAGAAGTGTTTTGG - Intronic
1047241106 8:123089221-123089243 GCTTGGAACCAGAAATGTTTTGG - Intronic
1047476885 8:125241009-125241031 ACCTGGGACCAGAAGTGTTTTGG + Intronic
1047488551 8:125355102-125355124 GCTTGGGACCAGAAGTGTTTCGG - Intronic
1047536369 8:125723753-125723775 GCTTGGGACCAGAAGTGTTTTGG + Intergenic
1048238751 8:132719531-132719553 GCTTGGAACCAGAAGTATTTTGG - Intronic
1049556407 8:143284503-143284525 GCTTGGGACCAGAAGTGTTTTGG - Intergenic
1049945954 9:595925-595947 GCTTGGGACTAGAAGTATTTCGG + Intronic
1050216570 9:3332194-3332216 GCTTGGGACCACAAGTGTTTTGG + Intronic
1050377389 9:4986663-4986685 GCTTGGGACCAAAAGTGTTTTGG + Intronic
1050381776 9:5038566-5038588 GCTTGGGACCAGAAGTGTTTTGG + Intronic
1050453870 9:5813479-5813501 GCTTGGGATCAGAAGTATTTTGG + Intronic
1051689758 9:19698429-19698451 GCTTGGAACCAGAAGTGTTTTGG - Intronic
1051783313 9:20714108-20714130 GCTCGGGACCAGAAGTGTTTTGG + Intronic
1051806042 9:20993437-20993459 GCTTGGGACCAGAGGTGTTTTGG + Intronic
1051835247 9:21330123-21330145 GCTTGGGACCAGAAGTGTTTTGG + Exonic
1052294012 9:26877310-26877332 GCTTGGGGCCAGAAATGTTTTGG - Intronic
1052773050 9:32706871-32706893 GCCAGGGAGCAGGTGTGTTTGGG - Intergenic
1053136696 9:35655332-35655354 GCCATGGACCAATAGTGTTGGGG + Intergenic
1053232134 9:36419215-36419237 GCTTGGGACCAGAAGTGTTTGGG - Intronic
1054355678 9:64059762-64059784 GTTTGGAACCAGAAGTGTTTTGG - Intergenic
1054824639 9:69560669-69560691 GCTTGAGACCAGCAGTGTTTGGG + Intronic
1054892889 9:70270989-70271011 ACTTGGGACCAGAAGTGTTTTGG + Intronic
1054894258 9:70290093-70290115 GCTTGGCACCAGAAGTGTTTTGG - Intronic
1055311328 9:74984734-74984756 GCTTGGGACCAGAAATGTTTGGG - Intronic
1055767159 9:79675822-79675844 GCTTGGGACTAGAAGTGTTTTGG + Intronic
1056120071 9:83478951-83478973 TCTAGGGACCCGTAGTGCATAGG - Intronic
1056143090 9:83703548-83703570 GCTTGGGACCAGAAGTGTTTGGG - Intronic
1056237195 9:84606422-84606444 GCCTGGGACCAAAAGTGTTTAGG + Intergenic
1057011954 9:91612252-91612274 GCTAGGGACCAGTGATGCCTGGG + Intronic
1057486900 9:95492658-95492680 GTTTGGGACCAGAAGTGTATGGG - Intronic
1057597502 9:96427535-96427557 GCTTGGGACCAGAAGTGTTTGGG + Intergenic
1057923731 9:99123118-99123140 GCTCAGGACCAGAAGTGTTTTGG - Intronic
1057976904 9:99614929-99614951 GCTTGGGACAAGAAGTGTTTTGG - Intergenic
1058014213 9:100011878-100011900 GCTTGGGATCAGAAGTGTTTTGG + Intronic
1058363167 9:104174872-104174894 GCTTGGGAGCAGAAGTGTTTTGG - Intergenic
1058497196 9:105571976-105571998 GCTTGGGACCAAAAGTATTTTGG - Intronic
1058511816 9:105727457-105727479 GGTTGGGACCAGAAGTGTTGTGG + Intronic
1058694893 9:107550907-107550929 GCTTGAGACCAGAAGTGTTTTGG - Intergenic
1060371071 9:123072068-123072090 GCTTGGGACCGGAAGTGTTGTGG + Intronic
1061174827 9:128988556-128988578 GCTTGGGACCAGAAGTGTTTTGG + Intronic
1062313445 9:135952719-135952741 GCCCGGGACCAGAACTGTTTCGG + Intronic
1062647197 9:137554216-137554238 GCTTGGAACCAGAAATGTTTTGG + Intergenic
1062679116 9:137767438-137767460 GCTTGGGACCAGAAGTGTTTTGG + Intronic
1203744018 Un_GL000218v1:28890-28912 GTTTGGAACCAGAAGTGTTTAGG - Intergenic
1203566094 Un_KI270744v1:90648-90670 GTTTGGAACCAGAAGTGTTTAGG + Intergenic
1186144081 X:6607527-6607549 ACTTGGGACAAGAAGTGTTTTGG - Intergenic
1186484928 X:9926896-9926918 GCTTGGGACCAGAAGTGTTTTGG - Intronic
1186551620 X:10511742-10511764 GCTTAGAACCAGAAGTGTTTTGG + Intronic
1186681794 X:11882738-11882760 GCTTGGGACAAGAAGTGTTTCGG - Intergenic
1187183887 X:16966373-16966395 GCTTGGGACCAGAAGTGTTTTGG + Intronic
1187350514 X:18510967-18510989 GCTTGAGACCAGAAATGTTTTGG + Intronic
1187457436 X:19454780-19454802 GCTCGGGACCAGAAGTGCTTTGG + Intronic
1187483599 X:19681004-19681026 GCTTGGGACCAGAAGTGTTTTGG + Intronic
1187488595 X:19728149-19728171 GCTTGGGACCAGAAGTGTCTTGG + Intronic
1187699338 X:21949965-21949987 GCTTGGGACCGAAAGTGTTTTGG - Intronic
1187860446 X:23677497-23677519 GCTTGGGACCAGAAGTGTTTTGG - Intronic
1187988116 X:24836784-24836806 GCTTACGACCAGAAGTGTTTGGG + Intronic
1188001378 X:24985764-24985786 GCTTGGGACCAGAAGTGTTTTGG - Intronic
1188059221 X:25580162-25580184 GCTTGGGACAAGAAGTGTTTTGG - Intergenic
1188362844 X:29277716-29277738 GCTTGGGACCAGAAGTGTTTTGG + Intronic
1188550778 X:31362544-31362566 GCTTGGGACCAGAAGTGTTTTGG - Intronic
1188658418 X:32729270-32729292 GCTTGGGACCAGAAGTGTTTTGG - Intronic
1188812611 X:34670078-34670100 GCTTAGGACCAGAAGTGTTTGGG + Intergenic
1188874147 X:35409477-35409499 GCTTGGGACCTGAAGTGTTTCGG - Intergenic
1189299044 X:39939089-39939111 TCCTGGGACCAGAAGTGTTTTGG - Intergenic
1189525619 X:41817544-41817566 CCTTGGGACCAGAAGTGTTTTGG + Intronic
1189821969 X:44878108-44878130 GCTTGGAACCAGATGTGTTTTGG + Intronic
1189827698 X:44936616-44936638 GCTTGGGACCAGAAGTGTTTCGG + Intronic
1189976803 X:46469035-46469057 GCTTGGAACCAGAAGTGTTTTGG - Intronic
1190022666 X:46893429-46893451 GCTTGGGACCAGAAGTGTTTTGG + Intronic
1190085406 X:47391361-47391383 ACTTGGCACCAGAAGTGTTTTGG + Intronic
1190784325 X:53629455-53629477 ACTTGGGACCAGAAGTATTTTGG - Intronic
1190794454 X:53727923-53727945 CCTTGGGGCCAGAAGTGTTTTGG + Intergenic
1191652347 X:63553262-63553284 GCTTGGGACAAGAAGTGTTTGGG - Intergenic
1192469453 X:71384817-71384839 GCTTGTGACCAGAAGTGTTTCGG - Intronic
1192599882 X:72451038-72451060 ACTTGGGACCAGAAATGTTTTGG - Intronic
1193132637 X:77933506-77933528 GCTTAGGACCGGAAGTGTTTCGG + Intronic
1193150663 X:78120870-78120892 GCTTGGGACCATAAATGTTTTGG + Intronic
1193380538 X:80811311-80811333 GCTTGGGACCAGAAATGTTTTGG + Intergenic
1193808360 X:86020723-86020745 GCTTGGGACCAGAAGTGTTTCGG - Intronic
1193808371 X:86021197-86021219 GCTTGGGACCCGAAGTGCTTCGG - Intronic
1194449462 X:94026888-94026910 ACCTGGGACCAGAAGTGTTTTGG + Intergenic
1194546864 X:95246558-95246580 GCTTGGGACCGGAAGTATTTTGG - Intergenic
1195623465 X:106982975-106982997 GCTTGGGACCAGAAGTGTTTTGG + Intronic
1196090664 X:111738294-111738316 GCTTGGGACCAGAAGTGTTTTGG + Intronic
1196106108 X:111897189-111897211 GCTTGGTACCAGAAGTGTTTTGG - Intronic
1196274809 X:113754688-113754710 TTTTGGGACCAGAAGTGTTTTGG + Intergenic
1196904952 X:120422104-120422126 GCTTGGGACCAGAAGTGTTTTGG - Intergenic
1197288165 X:124621101-124621123 GCTTGAGACTAGAAGTGTTTTGG + Intronic
1197813124 X:130467054-130467076 GCTAGGGCCTAGTAGTGTTAAGG - Intergenic
1198089650 X:133315086-133315108 GCTTGGGACAAGAAGTGTTTGGG + Intronic
1198251883 X:134887045-134887067 GCTTGAGACCAGAAGTGTTTAGG - Intergenic
1198488617 X:137114800-137114822 GCTTGGAAGCAGAAGTGTTTGGG - Intergenic
1199885152 X:152013228-152013250 GCTTGGGACTAGAAGTGTTTTGG + Intergenic
1200324121 X:155220002-155220024 GCTTGGGACCAGAATTGTTTTGG - Intronic
1201157335 Y:11143872-11143894 GTTTGGAACCAGAAGTGTTTAGG - Intergenic
1202274983 Y:23108286-23108308 GCTTGAAACCAGAAGTGTTTCGG + Intergenic
1202291045 Y:23312403-23312425 GCTTGAAACCAGAAGTGTTTCGG - Intergenic
1202427974 Y:24742008-24742030 GCTTGAAACCAGAAGTGTTTCGG + Intergenic
1202442817 Y:24928083-24928105 GCTTGAAACCAGAAGTGTTTCGG - Intergenic