ID: 1126998907

View in Genome Browser
Species Human (GRCh38)
Location 15:54479148-54479170
Sequence CTGCAGTGCTTCAATAATCA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 170}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126998906_1126998907 -6 Left 1126998906 15:54479131-54479153 CCAGTGCTTCAAGTGCTCTGCAG 0: 1
1: 0
2: 2
3: 14
4: 152
Right 1126998907 15:54479148-54479170 CTGCAGTGCTTCAATAATCACGG 0: 1
1: 0
2: 0
3: 18
4: 170
1126998905_1126998907 13 Left 1126998905 15:54479112-54479134 CCTTGAATATATATGCTGTCCAG 0: 1
1: 0
2: 0
3: 10
4: 141
Right 1126998907 15:54479148-54479170 CTGCAGTGCTTCAATAATCACGG 0: 1
1: 0
2: 0
3: 18
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126998907 Original CRISPR CTGCAGTGCTTCAATAATCA CGG Intronic
901677548 1:10895246-10895268 CTGCAATGCTTTAGTAATCAGGG + Intergenic
901911575 1:12463158-12463180 CGGCTGTGCCTCAATGATCACGG - Intronic
902025315 1:13378859-13378881 CTGAGATGCATCAATAATCAGGG + Intergenic
902222398 1:14975186-14975208 CTGCAGAGCTCCAATACCCAGGG + Intronic
903027570 1:20440582-20440604 CTGCAGTGCTCTACTGATCATGG + Intergenic
909143283 1:71894326-71894348 CTGTAGTAGTTCAAGAATCAGGG + Intronic
909854576 1:80512211-80512233 CTGCAGGACTTGAATATTCATGG + Intergenic
913344386 1:117793518-117793540 CTCCAGTGCTTCAGGAATCAAGG + Intergenic
916864723 1:168843995-168844017 CTGCAGTGCTTCAATTTCAATGG - Intergenic
917569878 1:176254063-176254085 CTGTAGTGCTGCAGTAAGCATGG + Intergenic
921384992 1:214559608-214559630 ATGGATTGCTTCAATATTCAAGG - Intergenic
922403643 1:225287805-225287827 GTGAAGTGCTAAAATAATCATGG + Intronic
923362945 1:233230295-233230317 CTGGAGTGCATCAACAATTAAGG + Intronic
923939597 1:238806829-238806851 CTGCAGGGCCTTAATAATCACGG + Intergenic
1064612065 10:17114056-17114078 GTGCAGTGTTTCAACACTCAAGG - Exonic
1068511917 10:57977453-57977475 CAGTAGTGCTGCAATAAACATGG - Intergenic
1071088916 10:81896864-81896886 CTCCAGAGCTGCAATAATGATGG + Intronic
1071180491 10:82978030-82978052 CTGCAGTGCTCAAATAATAAAGG - Intronic
1072589461 10:96814845-96814867 CTGTAGTGCCTCACAAATCAAGG - Intergenic
1074226187 10:111486815-111486837 TTGTACTGCTTCAATAATCAAGG + Intergenic
1075241278 10:120781096-120781118 CTACAGAGCATCATTAATCAAGG - Intergenic
1077959684 11:7062088-7062110 CTACAGAGCTTTAAAAATCAAGG - Intronic
1085190471 11:74616561-74616583 TTGCAGTGCTTCCATATACAAGG - Intronic
1085862945 11:80256158-80256180 CTGGAGTGCATCAGTAATTAGGG + Intergenic
1087910709 11:103750413-103750435 CTGTAGTGCTTCACTTTTCAAGG + Intergenic
1091793839 12:3286284-3286306 CTGCAGTGAGTCAATAGTCCAGG + Exonic
1092251360 12:6899572-6899594 GTGCAGTGGTGCAATCATCATGG - Intronic
1098571014 12:71987336-71987358 CTGCAGTGCTTAAAAAAGCCTGG - Intronic
1100521360 12:95379179-95379201 TTTCAATGCTTCAATAACCATGG + Intronic
1100662295 12:96713233-96713255 TAGCAGTGCTGCAATAAACATGG - Intronic
1105677679 13:22691071-22691093 CTTCACTGCTTTACTAATCATGG - Intergenic
1108969448 13:56354675-56354697 CTACAGGGCTTTAAAAATCATGG + Intergenic
1109184142 13:59248909-59248931 CTGCTGGCCTTCGATAATCAGGG - Intergenic
1109644879 13:65240623-65240645 TTGCAGGGCTTCAATATTTAAGG + Intergenic
1109855259 13:68118841-68118863 ATGCAGTCCTTCCAAAATCATGG - Intergenic
1113653114 13:112051662-112051684 CAGCTGTGCTTCTATATTCAAGG + Intergenic
1114843201 14:26290335-26290357 CTGCAGTTCTTCAGTATCCATGG + Intergenic
1114962237 14:27907997-27908019 CTTCAGAGCTACAGTAATCAAGG + Intergenic
1115329384 14:32178953-32178975 ATGAAGTGCTGCAATAAACATGG + Intergenic
1115736458 14:36336332-36336354 ATGAATTGCTTGAATAATCAAGG + Intergenic
1116045941 14:39742328-39742350 GTGAAGTGCTGCAATAAGCATGG + Intergenic
1117161021 14:52989805-52989827 CAACAGTGCTGCAATAAACATGG + Intergenic
1117785884 14:59284367-59284389 CTGCAGTTCTATAATACTCATGG - Intronic
1118556446 14:67028306-67028328 GAACAGTGCTTCAGTAATCATGG + Intronic
1120636743 14:86962153-86962175 GAACAGTGCTTCAATAAACATGG + Intergenic
1120772460 14:88395807-88395829 CTGTAATGCTACAATAATTAAGG - Intronic
1121277776 14:92679414-92679436 CTGCCCTACTTCAATAGTCAGGG + Intronic
1122478485 14:102029140-102029162 TTGCTGTGCTTCAGAAATCAAGG + Intronic
1122853705 14:104549762-104549784 CTGCAGTGCGTCTGTCATCATGG + Intronic
1125115961 15:36091942-36091964 ATCCAGTGCTTCAACTATCAAGG + Intergenic
1126998907 15:54479148-54479170 CTGCAGTGCTTCAATAATCACGG + Intronic
1127476054 15:59334228-59334250 GTGCAGTGATGCAATAATCATGG - Intronic
1127968410 15:63941092-63941114 CTTCAGTGCTTTAAGAAACAGGG - Intronic
1128021422 15:64394094-64394116 CAGCAGTGCTTCAAAAAAGATGG + Exonic
1129376559 15:75137425-75137447 CTGCAGCCCTTCACTAATCATGG - Intergenic
1130372983 15:83302770-83302792 GTGCAGTTCTGCAATAATCCTGG + Intergenic
1131946509 15:97627956-97627978 CTTGAGTGCTTCCATCATCATGG + Intergenic
1132119157 15:99161463-99161485 CTGCAGGACTTCAATAAGCAGGG + Intronic
1132158959 15:99519116-99519138 GTGCAGTGCTGCGATGATCATGG + Intergenic
1133573818 16:7068300-7068322 CTGCAGTGTTTGAATACACATGG - Intronic
1135237529 16:20771676-20771698 GTACAGTGCTGCAATAAACATGG + Intronic
1137938028 16:52653958-52653980 CTGCCAAGCTTCAGTAATCACGG - Intergenic
1138060745 16:53887583-53887605 CTGAGGTGCTCCAATATTCAAGG + Intronic
1138155860 16:54702302-54702324 CTTCAGTGCTTCAACAGCCAGGG + Intergenic
1138762244 16:59559008-59559030 CTGCAGTTCTTCTTTATTCAAGG - Intergenic
1138765128 16:59592802-59592824 CTGCAGGTCTTGAATAATGATGG - Intergenic
1140235402 16:73154158-73154180 CTGCAGTTCTGCAATACCCAAGG - Intergenic
1140297519 16:73723885-73723907 CTTCAATGCTTAAATAATCAGGG - Intergenic
1140945819 16:79767546-79767568 TTTCACTGCTTCCATAATCAGGG - Intergenic
1142941107 17:3380372-3380394 CTGCAGTCGCTCAGTAATCAGGG - Intergenic
1146019399 17:29264087-29264109 CTGAAGTGATACACTAATCACGG - Exonic
1146405661 17:32534881-32534903 CTGCTGTGCTTCAGTCAACAGGG + Intronic
1150357520 17:64499796-64499818 CTGCAGTGCAGCAGTAATTATGG - Exonic
1153959384 18:10127707-10127729 CTGCAGTGCTGCAAGACTCCTGG + Intergenic
1154148584 18:11887268-11887290 CTGCAGAGCTTCTGTAATCTGGG - Intronic
1155508899 18:26557832-26557854 CTGCAGAGCTTCAAGAATGCAGG - Intronic
1156413659 18:36863408-36863430 CTATAGTGCTACAGTAATCAAGG - Intronic
1156758174 18:40554057-40554079 CTGCATTTTTTCAATAATAATGG - Intergenic
1157055557 18:44224322-44224344 TTGCATTTCTCCAATAATCAGGG + Intergenic
1158813781 18:61070241-61070263 CTGCTGAGCTTCAATAAGGATGG - Intergenic
1164453351 19:28385839-28385861 CTGCTGTTCTTGAATAAACATGG - Intergenic
1164906571 19:31973040-31973062 CTGCAGGGCTGCAAAAATCAGGG + Intergenic
1165535565 19:36441630-36441652 CAACAGTGCTGCAATAAACATGG + Intergenic
1165622054 19:37256497-37256519 CTGCATTTCTTCAATTAACAGGG - Intergenic
1165633665 19:37322714-37322736 CTGCATTTCTTCAATTAACAGGG - Intronic
925116132 2:1379577-1379599 CAGATGTGCTTCAATAATCTCGG + Intronic
925670637 2:6306502-6306524 TTGCATTTCTCCAATAATCAGGG - Intergenic
927982793 2:27385027-27385049 CAGCAGCTCTTCAATAGTCATGG + Exonic
928839543 2:35588250-35588272 CTTCAGTCCTTCAATTATCAGGG - Intergenic
932388796 2:71365768-71365790 CTGCAGTGGTGCAACAAGCATGG + Intronic
933289361 2:80420703-80420725 CTGCAGTGCTGGATTAACCAAGG - Intronic
934132533 2:88962614-88962636 CAGCAGTGCTTGACTAATAATGG + Intergenic
935835205 2:107043588-107043610 TTGCAGTGCTGCAATAAACATGG - Intergenic
938999698 2:136720166-136720188 CTAGAGTGCCTAAATAATCAAGG + Intergenic
939144965 2:138402441-138402463 GTGAAGTGCTGCAATAAACATGG - Intergenic
940166732 2:150781972-150781994 CTCCAGTGCATTACTAATCAGGG + Intergenic
944615974 2:201460805-201460827 CAGTAGTGCTGCAATAAACATGG + Intronic
944653571 2:201856321-201856343 CTGTAGGGCTTCCATAATCCTGG - Intronic
945580883 2:211592957-211592979 GTGCAGTGGTGCAATAATCTTGG - Intronic
946138482 2:217667768-217667790 CATCAGTGTTTCAATATTCAAGG + Intronic
948966774 2:241388182-241388204 TTGTAAAGCTTCAATAATCAAGG + Intronic
1170776635 20:19380425-19380447 CTGCAGTGCTTTAATAAGGGTGG + Intronic
1170904207 20:20497630-20497652 CTACAAAACTTCAATAATCACGG - Intronic
1174952256 20:55055115-55055137 CTGCATGCCTTCAATATTCAGGG - Intergenic
1182672718 22:32010734-32010756 TTGCAGTGCTTCTAAGATCATGG - Intergenic
1184305456 22:43597778-43597800 GAGCAGTGCTGCAATAAACATGG - Intronic
951493100 3:23295231-23295253 GTGCAATGCTCCAAAAATCAAGG - Intronic
954866054 3:53730784-53730806 CTGCAGTGATTCTTTAAGCATGG - Intronic
955151317 3:56370132-56370154 GTGGAGTGCCTGAATAATCAAGG - Intronic
955155806 3:56415525-56415547 CTACAGTGCTTCCTTACTCATGG - Intronic
957860917 3:85947335-85947357 CAGCAGTACTTCGATAATAAAGG + Intronic
958963294 3:100531489-100531511 CAGCACTGCTTTAATTATCAAGG + Intronic
958963302 3:100531622-100531644 CAGCACTGCTTTAATTATCAAGG + Intronic
960014057 3:112865969-112865991 GAACAGTGCTTCAATAAACATGG + Intergenic
960272913 3:115693917-115693939 CTGCAGTTTTTCAATAAGCCAGG - Intronic
963540749 3:146584434-146584456 CTGCATTGCTTCCAGAATGAAGG + Intronic
964515466 3:157503322-157503344 CTGCAGTGCTCTAAAGATCAAGG - Exonic
968012283 3:195291679-195291701 CTGCAGTGCTTTCATATTTAAGG - Intronic
968851199 4:3079811-3079833 CTGCAGTGCTCAGATAAGCATGG + Intronic
969855964 4:9999839-9999861 CTGCAGTGGTCCAAAGATCATGG + Intronic
969857629 4:10013223-10013245 CTTCAGTGCTGCCATAACCAGGG + Intronic
970615260 4:17762922-17762944 GTGCAGTGATTCAAAAGTCAGGG - Intronic
971794262 4:31205942-31205964 CTGCAATTATCCAATAATCAAGG - Intergenic
973054291 4:45635356-45635378 CAGCAGTGTTCCAATAAACATGG - Intergenic
977113520 4:92991212-92991234 TTGCAGGGCTGTAATAATCATGG + Intronic
978424320 4:108566371-108566393 CTGAAGTTCTTCAATAAAAAAGG + Intergenic
982949321 4:161669395-161669417 CTACAAAGCTACAATAATCAAGG + Intronic
983081463 4:163390447-163390469 CTTCATTTCTTCAATAAACAGGG - Intergenic
983523808 4:168739207-168739229 CTACAGTGCTGCAGTAAACATGG + Intronic
983896645 4:173088188-173088210 GAGCAGTGCTGCAATAAACATGG + Intergenic
984147339 4:176079312-176079334 CTGCAGTGCTGCAGTAAACATGG + Intronic
984707786 4:182860624-182860646 CTGCAGGGGTTCACTAATGAAGG + Intergenic
986387972 5:7256138-7256160 GAGTAGTGCTTCAATAAACATGG + Intergenic
993451645 5:88078296-88078318 TTGCATTTCTCCAATAATCAGGG - Intergenic
994244579 5:97465761-97465783 CTGGAGCCCTTCAAGAATCAAGG + Intergenic
994513586 5:100741054-100741076 CTATAGAGCTACAATAATCAAGG - Intergenic
994800298 5:104365461-104365483 GTGCAGAGCTTCCATAATAATGG - Intergenic
995414577 5:111894727-111894749 CTGTTGTGCATCAACAATCATGG - Intronic
997950552 5:138239414-138239436 CTGCAGTTGTTCATTCATCAAGG + Intergenic
999560490 5:152796446-152796468 CAATAGTGCTTCAATAAACATGG - Intergenic
1001354211 5:171004311-171004333 CTGCAGTCCAGGAATAATCAGGG + Intronic
1002327410 5:178418835-178418857 CTGCAGTCCTGCCAGAATCAGGG - Intronic
1003275816 6:4651549-4651571 CTAAACTGCTACAATAATCAAGG + Intergenic
1003340072 6:5212217-5212239 CTGCAGAGCTACAATAAGCCAGG + Intronic
1003805143 6:9719676-9719698 CTGCAGTGCTTGGCTATTCATGG - Intronic
1004452475 6:15759390-15759412 CTACAATGCTTCAATTCTCAAGG - Intergenic
1005316014 6:24603601-24603623 CTGCAGTGCTTCTGGAAACAGGG - Intronic
1008421547 6:51306245-51306267 TTGCAGTCATTCAATAATCATGG + Intergenic
1008979011 6:57461944-57461966 TTGGAGTGCTTAAATAATAAAGG - Intronic
1009905186 6:69861819-69861841 CTGTAGAGGTTAAATAATCAAGG - Intergenic
1010142292 6:72625080-72625102 CTGAAGTACCTCATTAATCACGG - Intronic
1010477685 6:76308487-76308509 CTGGACTCCTTCAAGAATCACGG + Intergenic
1013571930 6:111436324-111436346 ATATAGTGCTTCAATAAACATGG - Intronic
1016800501 6:148164142-148164164 CTGAAGTGATTCAAACATCAGGG - Intergenic
1019561527 7:1661432-1661454 GTGCAGTGCTTAAATCATCATGG - Intergenic
1020725927 7:11814545-11814567 CTGCAGTGCTTGATCAACCAAGG + Intronic
1020929279 7:14372886-14372908 TTGCATTGATTCAATAATCAAGG - Intronic
1021344642 7:19509829-19509851 CAGCAGGGTTTCAATTATCAAGG + Intergenic
1024766996 7:52671260-52671282 CTGGAGTGATTCGTTAATCATGG + Intergenic
1027443003 7:78240363-78240385 GAGTAGTGCTTCAATAAACATGG - Intronic
1027870698 7:83703265-83703287 CTCCAGTGCTATAATAACCATGG + Intergenic
1030471650 7:109971418-109971440 ATGCAGTGCTACAATAAACACGG - Intergenic
1031788363 7:126064675-126064697 GAACAGTGCTTCAATAAACATGG - Intergenic
1033005842 7:137561126-137561148 GAGCAGTGCTGCAATAAACATGG - Intronic
1033179941 7:139166739-139166761 CTTCAGTACTTAAATATTCATGG - Intronic
1033925960 7:146460476-146460498 GAACAGTGCTTCAATAAACATGG - Intronic
1038317997 8:26503717-26503739 CAGCAGTGATTCAAGAATCTTGG + Intronic
1040531063 8:48266663-48266685 CTCCAGGGATTCTATAATCATGG - Intergenic
1043980825 8:86637054-86637076 CTGCAATGCTGCAATGAACATGG + Intronic
1051291650 9:15551901-15551923 TTTCAGTGCTACAAGAATCAAGG + Intergenic
1052703444 9:31965556-31965578 TTGCAGTTCTTGAATCATCAGGG - Intergenic
1054840118 9:69729459-69729481 CTGTAGCCCTTCAATAATGAGGG - Intronic
1056593245 9:87982035-87982057 GTGCTGTGCTGCAATAAACATGG - Intergenic
1057060338 9:91998540-91998562 CTGAAGTTCTTCAGAAATCAGGG + Intergenic
1060079622 9:120630450-120630472 GTGAAGTGCTGCAATAAACATGG + Intronic
1186557878 X:10579756-10579778 CTGCAGAGCTTCAGTGATCAGGG - Intronic
1188761092 X:34030897-34030919 CTGCATAGCTTGATTAATCATGG - Intergenic
1191859699 X:65656159-65656181 CTGCAATACTATAATAATCAAGG - Intronic
1192865096 X:75122461-75122483 CTGCAATGCTGCAATGAACATGG + Intronic
1194651114 X:96515338-96515360 CTTCAATGCTTCAATGAACATGG - Intergenic
1194705671 X:97172608-97172630 ATGCACTGCTTGAAAAATCAAGG + Intronic
1194783347 X:98051713-98051735 GAACAGTGCTTCAATAAACATGG + Intergenic
1195228223 X:102819503-102819525 CTGTAGTGCTTCACTTTTCAAGG + Intergenic
1195467126 X:105191817-105191839 CTGCAGAGTTTCACTATTCAGGG + Intronic
1195512351 X:105731512-105731534 CAATAGTGCTTCAATAAACATGG - Intronic
1196057061 X:111367282-111367304 CTGCAGATCTCAAATAATCAGGG - Intronic
1197149280 X:123202698-123202720 CTGCCGTGCTGCAAAGATCATGG + Intronic
1199327367 X:146514672-146514694 AAGCAGTGCTGCAATAAACATGG + Intergenic
1199976713 X:152898567-152898589 CTGCAGGCCTTTAAGAATCAGGG + Intergenic