ID: 1127003141

View in Genome Browser
Species Human (GRCh38)
Location 15:54533807-54533829
Sequence ATGTGTCCACAGTTGGGATT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 165}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127003137_1127003141 -10 Left 1127003137 15:54533794-54533816 CCTACAATTTGTAATGTGTCCAC 0: 1
1: 0
2: 0
3: 6
4: 117
Right 1127003141 15:54533807-54533829 ATGTGTCCACAGTTGGGATTGGG 0: 1
1: 0
2: 1
3: 12
4: 165

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127003141 Original CRISPR ATGTGTCCACAGTTGGGATT GGG Intronic
900764601 1:4495404-4495426 ATGTGTACACAGTGGCTATTAGG + Intergenic
903610211 1:24605917-24605939 ATGTGGACACAGTTGGGGTAGGG - Exonic
904888832 1:33762578-33762600 CTGTGTTCACAGTTTGGTTTTGG + Intronic
905273036 1:36799458-36799480 ATGTGTGCACAGTGGGGAGCGGG - Exonic
907520134 1:55018490-55018512 ATCTGTCCTCACGTGGGATTAGG + Intergenic
908293643 1:62691987-62692009 ATGTGTTCTCTTTTGGGATTTGG + Intergenic
910174042 1:84409499-84409521 ATGTATCCACAGGCTGGATTTGG + Intronic
913424600 1:118713381-118713403 ATGGTGCCACAGTTGGGGTTTGG - Intergenic
915814235 1:158949919-158949941 ATGTAGCCACAATTGGGTTTGGG + Intronic
919038273 1:192345452-192345474 ATGTGTCAATATTTGGGGTTTGG + Intronic
920262050 1:204695026-204695048 ATTTGTCCTCAGTTGAGAGTTGG + Intergenic
922087952 1:222369090-222369112 AAGTGTGCATAGTTGGGATCTGG + Intergenic
922638316 1:227200008-227200030 ATGGGTTCACAGTTTGGAGTAGG - Intronic
923559099 1:235024964-235024986 TTGTGTCATCAGCTGGGATTGGG + Intergenic
924426033 1:243951227-243951249 ATGTGTCCACAGAAAGGATATGG + Intergenic
1064377684 10:14811479-14811501 ATGTGTCAACAGTTTGTTTTTGG - Intergenic
1065751220 10:28889693-28889715 ATTTGTCCTCAGTTGTAATTAGG + Intergenic
1066002747 10:31119602-31119624 AGGTTTCCAAAGTTGGGAGTTGG - Intergenic
1072082709 10:92047760-92047782 TTGTGTCCAGAGTTGGTCTTGGG - Intronic
1073157806 10:101361861-101361883 ATGTGGCCAAGGTGGGGATTGGG + Intronic
1074025829 10:109633195-109633217 ATGTGTCAACATTTGGCATAAGG + Intergenic
1075932236 10:126309085-126309107 ATGTGTCCACTCTTGGCATAGGG - Intronic
1076082081 10:127591368-127591390 ATGTGTCCACAGTTTACATTAGG - Intergenic
1077680071 11:4231563-4231585 ATGTGCCCACCTTTGGGATGTGG + Intergenic
1080731124 11:34954363-34954385 CTGTGTACACAGATGAGATTAGG + Intronic
1088037198 11:105332335-105332357 ATGTGTTCTCAGTTGGAATCTGG + Intergenic
1088935404 11:114394818-114394840 ATTTGTCCACATCTTGGATTAGG + Intronic
1089367488 11:117929823-117929845 ATGTGCCCTGATTTGGGATTTGG - Intergenic
1090441929 11:126731357-126731379 CTGTGTCCACTGTTTGCATTGGG + Intronic
1090735656 11:129610374-129610396 AGGTGTCAACAGATGGGATATGG + Intergenic
1091349407 11:134881050-134881072 GTCTGTCCACAGTGGGAATTGGG - Intergenic
1092870122 12:12798785-12798807 ATGAGGCCACAGTTGTGATGTGG - Intronic
1094524566 12:31223071-31223093 CTGTGCACACAGTTGGGATGAGG - Intergenic
1096115883 12:49054741-49054763 GTGTGTCCACAGTGGGGGTCCGG - Exonic
1102316083 12:111888822-111888844 ATCTGTCCAGAGTTGGTTTTTGG + Intronic
1105432514 13:20350254-20350276 AAGTGTCCACAGTTAATATTTGG - Intergenic
1107295945 13:38907615-38907637 ATGTGCCCAGATTTGGGATGTGG - Intergenic
1107331813 13:39309559-39309581 ATGTGTCCCAATTTGAGATTTGG + Intergenic
1107615918 13:42167916-42167938 ATGTGTCAAAAGTTGAGATGAGG + Intronic
1109444963 13:62424509-62424531 ATCTCTCTAGAGTTGGGATTAGG - Intergenic
1109852049 13:68078022-68078044 TTGTGTCAACTGTTGTGATTTGG - Intergenic
1112464256 13:99629699-99629721 AAGTGGACACAGATGGGATTGGG + Intronic
1117717248 14:58593965-58593987 ATTTTTCCACAGCTGGGGTTGGG - Intergenic
1119602160 14:75983396-75983418 AGGTGTCAGCTGTTGGGATTTGG + Intronic
1120890013 14:89483350-89483372 ATTTGCCCAGAGTTGGGATTGGG - Intronic
1121263521 14:92583791-92583813 ATTTTTCCACAGATGGGATGGGG + Intronic
1121585659 14:95061378-95061400 ATGTGGCCACATTTGGAAATAGG - Intergenic
1122351920 14:101101075-101101097 ATGTGACCTCATTTGGAATTGGG + Intergenic
1123923903 15:25090071-25090093 CTGTGTCAACACTTGGGATGGGG + Intergenic
1124867166 15:33503752-33503774 TTGTGTCCTAGGTTGGGATTGGG + Intronic
1126958371 15:53960816-53960838 ATATGTGCATAGTTGGGATGAGG - Intergenic
1127003141 15:54533807-54533829 ATGTGTCCACAGTTGGGATTGGG + Intronic
1134803168 16:17104190-17104212 CTGTGTCAACACTTGGGATTTGG + Exonic
1135852475 16:25976990-25977012 CTGAGTCCACAGGTAGGATTTGG + Intronic
1138282559 16:55783269-55783291 GTGTGTCCACAGTTGATTTTCGG - Intergenic
1139218188 16:65150241-65150263 CTGAGTCTACAGTTGGGATCAGG - Intergenic
1142033694 16:87851135-87851157 ACGTGTCCACTGTTAGCATTCGG - Intronic
1149950019 17:60975963-60975985 TTGTTTCCACATTTGGGCTTAGG + Intronic
1151930688 17:77229849-77229871 ATGTGCCCACAGCTGGGACAAGG + Intergenic
1152560263 17:81075157-81075179 CTGTGCCCACATTTGGCATTGGG + Intronic
1159932122 18:74323863-74323885 ATGTGTGCATATTTGGGATGTGG - Intronic
1160281391 18:77494047-77494069 ATTTTTCCACAGATGAGATTGGG - Intergenic
1166447552 19:42871481-42871503 CTGTGAACACAGTGGGGATTTGG - Intronic
1167709741 19:51103241-51103263 GTATGGCCACAGTTGGGATCCGG + Intronic
926078146 2:9959492-9959514 TTGTGTTCACAGATAGGATTTGG + Intronic
926620269 2:15041025-15041047 ATGTGATCACAGTTGAGCTTTGG - Intergenic
927510293 2:23640115-23640137 ATGTCCTCACAGTTGGGCTTAGG + Intronic
929106925 2:38374758-38374780 CTTTTTCCACAGTTGGTATTAGG - Intronic
930736886 2:54788443-54788465 ATGTGTCCACGCTTAGGATTAGG + Intronic
933142390 2:78808844-78808866 AGGTTACCACAGTTGGGAGTAGG + Intergenic
933857605 2:86431430-86431452 ATCTGTCCAATGTTGAGATTGGG - Intergenic
935066123 2:99650108-99650130 AAGTTTCCACAGTTGGAATATGG + Intronic
935127364 2:100236153-100236175 ATGTGACCACATTTGGAAATAGG + Intergenic
936346706 2:111680933-111680955 ATGTGTCCTCATTTGGAAATAGG + Intergenic
938392134 2:130914916-130914938 ATGTGCCCACAGTTGAGTCTGGG - Intronic
940492551 2:154382153-154382175 CTGTGTCCATAGAGGGGATTGGG - Intronic
941775391 2:169387715-169387737 AGGTCTCCACAGTTGAGAGTGGG + Intergenic
943503290 2:188719359-188719381 CTGAGTCCACAGTTGGCATCTGG - Intergenic
943575459 2:189626175-189626197 ATGTTTCCACAGGTTGGCTTGGG + Intergenic
944617984 2:201482409-201482431 ATGGGTCCACAGCGGGGTTTGGG + Intergenic
945483865 2:210371162-210371184 AGGAGTCCACAGTTGGAATGTGG + Intergenic
945588231 2:211694124-211694146 ATGTGACCATATTTGGGAATAGG - Intronic
947917137 2:233839911-233839933 GTGTGTCCACAGTCAGGATCTGG - Intronic
948201337 2:236131465-236131487 GTGTATCCACAGATGGGTTTAGG + Exonic
949074124 2:242044432-242044454 AGGTTTCCACAGCTGGGCTTGGG - Intergenic
1169039175 20:2479060-2479082 ATGAGTCCACAGAAAGGATTTGG - Intronic
1170252034 20:14294001-14294023 ATGTGTCCCGATTTGGGACTTGG - Intronic
1170317960 20:15062955-15062977 ATCTGTCTGCAGATGGGATTTGG + Intronic
1170666083 20:18387302-18387324 ATGTATCCACAGTTCAGTTTTGG + Intronic
1171371735 20:24666764-24666786 CTGTGTCCACTGAGGGGATTAGG - Intergenic
1172973154 20:38888161-38888183 TAGTGTCCACGGTGGGGATTAGG + Intronic
1174253869 20:49239474-49239496 ATGTTTCCACATTTGGGGTGTGG + Intronic
1175764016 20:61580811-61580833 ACGTGAACACAGTTGGGACTGGG - Intronic
1177888943 21:26781598-26781620 CTGTGTCCAGAGTTTGTATTAGG + Intergenic
1179591889 21:42414533-42414555 ATGTGACCTCACTTGGGAATAGG + Intronic
1183512461 22:38244068-38244090 ATGTGGCCGCAGTTGGGGGTGGG + Intronic
950627833 3:14261121-14261143 ATGTGTCCACCATGGGGACTTGG - Intergenic
956335819 3:68162270-68162292 ATTTTTCCACAGATGGGGTTGGG + Intronic
957699371 3:83688738-83688760 ATGTGTCCATTGTTGAGAGTTGG + Intergenic
958722182 3:97857442-97857464 ATATGTCCAAAGTTGAGAGTGGG + Intronic
959956535 3:112244767-112244789 CTGTATCCACAGATGGAATTAGG + Intronic
967899612 3:194436033-194436055 ATGTGTCCTTAGTAGGAATTAGG + Intronic
971715032 4:30165291-30165313 ATGTGATCAGAATTGGGATTAGG + Intergenic
973760567 4:54110898-54110920 ATGTCCTCACAGTTGGGAATAGG - Intronic
975720856 4:77247471-77247493 ATGTGACTCCAGTGGGGATTTGG - Intronic
981074494 4:140577750-140577772 ATGTGACCTCATTTGGGAATAGG - Intergenic
981687827 4:147474749-147474771 ATACCACCACAGTTGGGATTAGG + Intergenic
984191694 4:176613479-176613501 ATGTGACCTTATTTGGGATTGGG + Intergenic
985110644 4:186543452-186543474 AGGTGGCCACAGTGGGTATTTGG - Intronic
988641845 5:33049328-33049350 AGGTGTCCACAGCTGTGATAGGG - Intergenic
990718768 5:58669275-58669297 ATGTGACCACATTTGGGATAGGG - Intronic
993232850 5:85260383-85260405 ATTTGACCACAGGTGGGATAGGG + Intergenic
994088736 5:95789139-95789161 ATGTGTCCTCAGGTGACATTTGG + Intronic
994450034 5:99929869-99929891 ATGGGTCCACAGCTGTGATTTGG + Intergenic
996402044 5:123073255-123073277 ATGTGTAGATAGTTGTGATTGGG + Intergenic
998963379 5:147511359-147511381 ATGTGTCCATACTTGGGAGGGGG - Intergenic
1000836182 5:166156909-166156931 ATGGGGCCACAGTTGGCATGAGG + Intergenic
1001922432 5:175611117-175611139 AACTGTCCAGAGATGGGATTGGG - Intergenic
1004031073 6:11870110-11870132 CTGTGTTCACATTGGGGATTAGG - Intergenic
1006067863 6:31475235-31475257 ATGTGTGCACAAGTGGGAATTGG + Intergenic
1006101667 6:31689544-31689566 ATGTGTCTACAGTGGGGGATGGG + Intronic
1007649840 6:43412649-43412671 CTGGGTCCACAGCTGGGGTTGGG - Intergenic
1008014592 6:46504131-46504153 ATGTGTCTGGAGTTGGCATTAGG + Intergenic
1008483540 6:52010946-52010968 ATTTTTTCACAGTTGGAATTAGG - Intronic
1008662864 6:53686942-53686964 GTGTGTACACAGTTTGGGTTTGG + Intergenic
1009618914 6:66046303-66046325 ATGTTTCCTCTGTTGGGTTTTGG + Intergenic
1011385793 6:86796512-86796534 AGATGTCCAGAGTTGAGATTTGG - Intergenic
1011398209 6:86932847-86932869 ATGTGTTCATAGGTGGCATTTGG - Intergenic
1013399061 6:109773533-109773555 ATTTGTTGACAGATGGGATTGGG - Intronic
1013613334 6:111817162-111817184 CTGTGTATACAGGTGGGATTTGG + Intronic
1015389726 6:132668004-132668026 ATGTCTCCACATGTGGAATTTGG + Intergenic
1015553885 6:134440919-134440941 ATTTTTCCACAGATGGGACTGGG - Intergenic
1018765693 6:166931533-166931555 ATGTGTCCACCGTGGGGAGGGGG - Intronic
1019263114 7:93417-93439 ACCTGTCCACACTTGGGGTTGGG - Intergenic
1020955884 7:14739876-14739898 ATGTGGCAGCAGTTGGGGTTGGG - Intronic
1023771933 7:43565445-43565467 ATGTGTCCAAAATTTGGGTTCGG + Exonic
1025161745 7:56667183-56667205 CTGTCTCCACAGTTGGAATTGGG + Intergenic
1025223915 7:57140105-57140127 CTCTCTCCACAGTTGGAATTGGG + Intergenic
1025745745 7:64241314-64241336 CTGTCTCCACAATTGGGATTGGG - Intronic
1028568831 7:92263885-92263907 ATGTGTCTTAATTTGGGATTTGG + Intronic
1028626017 7:92878109-92878131 ATGTGTCCATTGTTGAAATTGGG - Intergenic
1029704033 7:102266389-102266411 AGGGGTCCACACTTGGGCTTGGG + Intronic
1029899200 7:104022035-104022057 CTGGGTCCACAGTTGTGGTTTGG - Intergenic
1030246671 7:107390504-107390526 ATCAATCCACAGTTGGGATGAGG + Intronic
1032470512 7:132175063-132175085 ATGTTTACATAGCTGGGATTGGG + Intronic
1032590463 7:133187401-133187423 ATGTTTGCCCAGTTAGGATTTGG + Intergenic
1033230610 7:139594656-139594678 AGCTGTCCACAGTTGTGACTGGG - Intronic
1034098943 7:148435559-148435581 GTGGGTCCACAGTGGGGATCAGG - Intergenic
1036293477 8:7516380-7516402 CAGTGTGAACAGTTGGGATTTGG + Intergenic
1036329082 8:7804615-7804637 CAGTGTGAACAGTTGGGATTTGG - Intergenic
1039099769 8:33928604-33928626 ATGCTTTCACAGTGGGGATTAGG + Intergenic
1040422408 8:47252467-47252489 ATGTGTCCACGGTGGTGATGGGG + Intergenic
1042734252 8:71969841-71969863 ACGTGTCCTCAGTTATGATTAGG - Intronic
1045745644 8:105417817-105417839 ATATGACCAGAGTTGGAATTAGG + Intronic
1048374852 8:133814084-133814106 AAGTGTCCCAAGTTGGGGTTTGG - Intergenic
1049397494 8:142408092-142408114 ATGTGTCCACAGAGGGGAGTGGG - Intergenic
1050058501 9:1680258-1680280 AAGTATCCACATTTGGGAATTGG + Intergenic
1050535604 9:6628121-6628143 TTGTGTCCTTAGTTAGGATTTGG - Intronic
1052474250 9:28938022-28938044 AAGTGAAAACAGTTGGGATTTGG + Intergenic
1052835436 9:33246610-33246632 ATGTGTTCACAGATGGGCTGTGG - Exonic
1053090511 9:35271316-35271338 ATGTGGCCTCAGCTGGGAGTTGG + Intronic
1056486953 9:87068511-87068533 ATGTGGCCACAGTTAGAATTTGG - Intergenic
1056737678 9:89223792-89223814 CTGTGTCCACAGTGTGCATTTGG - Intergenic
1058054308 9:100434182-100434204 ATGTGTCCACAGTAGGGTAGGGG - Intronic
1059535204 9:115074286-115074308 ATGTCTTCACATTGGGGATTAGG - Intronic
1185669162 X:1792173-1792195 ATGGGTCCACAACTGGGATTTGG - Intergenic
1185669253 X:1792772-1792794 ATGGGTCCACAATTGGGATTTGG - Intergenic
1185947777 X:4396999-4397021 ATGTGACCACATTTGGAAATAGG + Intergenic
1186695836 X:12030912-12030934 ATGCCTCCACAGGTGGGTTTGGG + Intergenic
1187251665 X:17604432-17604454 CTGTTACCACATTTGGGATTGGG + Intronic
1187499996 X:19831826-19831848 ATGTGTCCCCAGATGGAATTGGG - Intronic
1188468230 X:30507193-30507215 ATGTGTCCACAGTGAGGAAAGGG + Intergenic
1188847549 X:35092169-35092191 AAGTCTACAGAGTTGGGATTTGG - Intergenic
1189051978 X:37655037-37655059 ATCTGTCCACAGTCGGTTTTAGG - Intronic
1195211504 X:102655205-102655227 ATGAGTCCATAATTGGGAGTTGG + Exonic
1195656522 X:107336647-107336669 GTGACTCCACAGTTGGGGTTTGG + Intergenic
1195890480 X:109688226-109688248 ATGTGGCCACAGATTTGATTAGG - Intronic
1198158199 X:133983619-133983641 ATGGGTCCAGGGTTGGGGTTGGG - Intronic
1200285906 X:154822099-154822121 ATGCGTCCACTGTTGAGAATGGG - Intergenic