ID: 1127005055

View in Genome Browser
Species Human (GRCh38)
Location 15:54559540-54559562
Sequence GTGAGCAATGAGGAGGTGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 414
Summary {0: 1, 1: 0, 2: 1, 3: 42, 4: 370}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127005055 Original CRISPR GTGAGCAATGAGGAGGTGGT TGG Intronic
900496720 1:2979084-2979106 GGGAGGAATGAGGGGGTGGGGGG - Intergenic
900975170 1:6012150-6012172 GTGATGAAGGTGGAGGTGGTGGG + Intronic
900975193 1:6012236-6012258 GTGATGAAGGCGGAGGTGGTGGG + Intronic
900975238 1:6012410-6012432 GTGATGAAGGCGGAGGTGGTGGG + Intronic
900975270 1:6012532-6012554 GTGATGAAGGCGGAGGTGGTGGG + Intronic
900975289 1:6012605-6012627 GTGATGAAGGCGGAGGTGGTGGG + Intronic
903892189 1:26577286-26577308 CTGAGCAAAGATGAGGGGGTGGG + Intergenic
903934706 1:26887452-26887474 ATGAGCAATAGGGAGGTTGTTGG - Intronic
904525888 1:31133591-31133613 GTGGGCAAAGGGGAGATGGTAGG - Intergenic
904757065 1:32773761-32773783 GCAAGCACTGAGGAGGTGGATGG + Exonic
905081794 1:35328965-35328987 TTGGGCAATGAGTAGATGGTAGG - Intronic
906662815 1:47594546-47594568 GTGGGCAAGCAGGAGGTTGTGGG - Intergenic
907396407 1:54193415-54193437 GTGAGCCATGTGGAGATGGAGGG + Intronic
908199508 1:61779887-61779909 GTGGGCAGCGAGGAAGTGGTGGG + Intronic
910996124 1:93106058-93106080 GGAAAAAATGAGGAGGTGGTGGG + Intronic
911035031 1:93533459-93533481 ATGACCAATGAGGAGGAGGAAGG + Intronic
911240112 1:95455811-95455833 CTGAGCTCTGGGGAGGTGGTCGG + Intergenic
911701011 1:100951729-100951751 GGGAGAAATCAGGAGGTTGTTGG - Intronic
913282217 1:117197312-117197334 GAGAGCAATGAGAAGGGGGAGGG - Intronic
913494400 1:119415060-119415082 GGGAGCAATGAGTATGTGGCAGG + Exonic
915389354 1:155527407-155527429 CTTAGCAATGTGGAGGTTGTTGG - Intronic
916017470 1:160762925-160762947 GAGAGCAACGAGGATGTAGTGGG + Intergenic
916062417 1:161109028-161109050 GTGAGCATTGAGAAGGTTTTAGG - Intronic
917278927 1:173360767-173360789 GTGAGAAATTAGGGGGTGGAAGG + Intergenic
917416435 1:174815131-174815153 GTGGGGAACGGGGAGGTGGTAGG - Intronic
919030318 1:192234120-192234142 GTGAGCCCTGAGGAGGGTGTGGG - Intergenic
919033077 1:192269723-192269745 GTGAGTAATGAGGATAAGGTGGG + Intergenic
919786500 1:201261600-201261622 GTGAGCAAGGGGGTGATGGTGGG + Intergenic
921195256 1:212750307-212750329 GTGAGCTGGGAGGAGGTGGGTGG + Intronic
922797830 1:228349914-228349936 GTCTTCAATGAGGATGTGGTGGG - Exonic
923046689 1:230361178-230361200 ATGAGCACTGTGGAGGTGGAGGG - Intronic
923425603 1:233865799-233865821 GTGAGCAAGGAAAAGGAGGTAGG - Intergenic
1062978634 10:1703412-1703434 GTGAGCAGTGAGGAGGCTGAGGG + Intronic
1063382356 10:5593687-5593709 GTGGGGGATGAGGAGGTGGTGGG - Intergenic
1064280684 10:13948591-13948613 CTGAGCAGAGAGCAGGTGGTGGG + Intronic
1064757269 10:18582428-18582450 GTGAGCAATTAAGAGGAGGCTGG + Intronic
1065664337 10:28041725-28041747 GACAGCAAGGAGGAGGTGGAAGG + Intergenic
1065771347 10:29081626-29081648 GTGAGAATGGAGGAGGTTGTTGG - Intergenic
1067272441 10:44803964-44803986 GTGAGCAATTAGGAGGGAGGAGG + Intergenic
1067528561 10:47053548-47053570 CTGAGCCATGGGGAGGTGTTGGG + Intergenic
1068970751 10:62956028-62956050 GTGATCTCTGAGGAGGTGCTGGG - Intergenic
1069277561 10:66611586-66611608 GTGAGAAATGAGGAGAGGGCAGG - Intronic
1069465555 10:68635664-68635686 GTGAAGAATGAGAAGGTAGTAGG + Intronic
1069870461 10:71529805-71529827 GTGGGTAAGGAGGAGGTGGGAGG - Intronic
1070180885 10:74012656-74012678 GAGAGGAGTGAGGAGATGGTGGG + Intronic
1070648778 10:78220177-78220199 CTGGGAAATGAGGAGCTGGTTGG + Intergenic
1070825648 10:79388898-79388920 GCCTGCAGTGAGGAGGTGGTAGG + Intronic
1071412834 10:85413645-85413667 GTGGAGAGTGAGGAGGTGGTTGG - Intergenic
1072430023 10:95362659-95362681 GTGAGCAATGATAAGGCGGGAGG - Intronic
1072497162 10:95973131-95973153 GTGAGCAAGGAGGAGGGGGCGGG + Intronic
1072511396 10:96129841-96129863 GTGAGCAAAGAGGTAGTAGTGGG + Exonic
1073150132 10:101305745-101305767 GGCAGCAATGGGGAGGTGGCAGG + Intergenic
1073804935 10:107087593-107087615 TTGAGCATTGACCAGGTGGTAGG - Intronic
1076618455 10:131771860-131771882 GTGAGCACTGAGGAGGCAGCAGG - Intergenic
1077293190 11:1809861-1809883 GTCAGCAGTAAGCAGGTGGTGGG + Intergenic
1077363133 11:2149689-2149711 GGGGGCTATGTGGAGGTGGTGGG + Intronic
1077491753 11:2864219-2864241 GTGGGCATTGAGGCGGAGGTGGG - Intergenic
1077992672 11:7425792-7425814 GTGAGCAGTCAGGACGTGGAGGG + Intronic
1078055240 11:8003827-8003849 GTGAGAAATGGTGGGGTGGTGGG - Intergenic
1079121418 11:17688011-17688033 GTGAGCAGTGAGCAGGCGGTGGG - Intergenic
1079940467 11:26674027-26674049 GTGAGGCATGAGGAGGTGTGAGG - Intronic
1080056208 11:27909233-27909255 GAGAGCAATGAAGAGATGCTAGG + Intergenic
1081502584 11:43680942-43680964 GTGGGGAATGAGGCGGGGGTCGG + Exonic
1082160516 11:48883798-48883820 CTGAGCAAAGAGGAGGGGGTGGG - Intergenic
1082161850 11:48896608-48896630 CTGAGCAAAGAGGAGGGGGTGGG + Intergenic
1082167435 11:48965053-48965075 CTGAGCAAAGAGGAGGAGGTGGG + Intergenic
1082236127 11:49821606-49821628 CTGAGCAAAGAGGAGGGGGTGGG - Intergenic
1082239585 11:49856152-49856174 CTGAGCAAAGAGGAGGGGGTGGG - Intergenic
1082242569 11:49888199-49888221 CTGAGCAAAGAGGAGGGGGTGGG + Intergenic
1082609630 11:55281526-55281548 CTGAGCAAAGAGGAGGGGGTGGG - Intergenic
1082657055 11:55869002-55869024 CTGAGCAAAGAGAAGGGGGTGGG + Intergenic
1082787090 11:57323297-57323319 ATGGGAACTGAGGAGGTGGTTGG - Intronic
1082811492 11:57481718-57481740 GTGAGCACTGAGGAAGGGGTGGG + Intergenic
1083356525 11:62070385-62070407 GGGAGGAGTGCGGAGGTGGTGGG + Intergenic
1083387291 11:62320985-62321007 GTGAGGAGTGAGTGGGTGGTGGG + Intergenic
1083423719 11:62571661-62571683 GTGAGCAATGAGGAGCTGCGGGG - Exonic
1083662907 11:64260058-64260080 CTGAGCAATGGGGAGGAGGTAGG + Exonic
1084659883 11:70540461-70540483 GCGGGCAGGGAGGAGGTGGTAGG - Intronic
1084750583 11:71202255-71202277 GGGAGGAATGAGGAGGGGATGGG - Intronic
1086098205 11:83071588-83071610 GTGAGCGGTGGGGAGGTGGGGGG - Intronic
1086216365 11:84387070-84387092 AAGAGCAAGGAAGAGGTGGTGGG - Intronic
1088545575 11:110955509-110955531 ATGTGCAATGAGGAGGGGGATGG + Intergenic
1089309149 11:117546512-117546534 GTGGGCAGTTAGGAGTTGGTGGG - Intronic
1089744621 11:120608006-120608028 CTGGGCAATGAGGAGGTCATGGG + Intronic
1090655258 11:128838389-128838411 GACAGCAATGAGGAGTTGGAAGG - Intronic
1091283665 11:134396395-134396417 GAGAGCAAAGAGGTGGTGGCAGG - Intronic
1092323213 12:7500926-7500948 GTGATTAATGAGGAGGTGACTGG - Intronic
1096747297 12:53737415-53737437 TTGAGGAATGAGGAGGAGCTGGG + Intergenic
1096755316 12:53794486-53794508 GTGATCCTTAAGGAGGTGGTAGG + Intergenic
1096770123 12:53930306-53930328 GTGGGGAAGTAGGAGGTGGTGGG - Intergenic
1096779038 12:53981814-53981836 GTGAGCAATGCAGAGGAGGAGGG - Intergenic
1097225802 12:57476229-57476251 GTGGGCTGTGAGGAGGTGGGAGG + Intronic
1099095625 12:78371316-78371338 GTGACAGATAAGGAGGTGGTTGG - Intergenic
1101791061 12:107928156-107928178 GTGAGCTATGAAGGGGAGGTGGG - Intergenic
1102044640 12:109822199-109822221 GTGGGCAGTGGGGAGGTGGGTGG + Intronic
1102601268 12:114032584-114032606 GCGTGCAATGTGGTGGTGGTGGG + Intergenic
1103110737 12:118275992-118276014 GTGAACAATGGGGATGTAGTAGG + Intronic
1103480106 12:121245248-121245270 GGGAGAAAAGAGGAGGTGGCAGG + Intronic
1103948383 12:124539411-124539433 GTGAGCATGAAGGAGCTGGTGGG - Intronic
1105338243 13:19495137-19495159 GTGAAAAGTGAGGAGGTGATTGG - Intronic
1105774037 13:23639745-23639767 GTGAGAACTGAGGCAGTGGTGGG + Intronic
1106367488 13:29096559-29096581 GTAAGCAATTAGGAGGAGGCTGG - Intronic
1107805215 13:44147276-44147298 GTCAGAAAAGAGGAGGTGTTTGG - Intronic
1108653261 13:52502980-52503002 GTGAAAACTGAGGAGGTGATTGG + Intergenic
1109585328 13:64394518-64394540 ATAAGCAGTGAGGTGGTGGTGGG - Intergenic
1110868040 13:80420094-80420116 GGGAGAAATGAGGAGATGGGGGG - Intergenic
1110868046 13:80420114-80420136 GGGAGAAATGAGGAGATGGGGGG - Intergenic
1112609932 13:100946164-100946186 CTGAGCAAGGTGGATGTGGTAGG - Intergenic
1113351711 13:109535935-109535957 CAGACCAATGAGGAGGTGATTGG + Intergenic
1114390310 14:22301036-22301058 GTGATAAATGATGAGGTGGGTGG - Intergenic
1114669454 14:24401113-24401135 TTGAGCAAGGAGGGGGTGGCGGG - Intronic
1114787605 14:25619041-25619063 ATGAGAAATGAGGCGGTGGTGGG + Intergenic
1115167857 14:30469876-30469898 GTGAGAGAAGAGGAGGTAGTAGG - Intergenic
1115573194 14:34686398-34686420 GTGAGGAAGAAGGAGGTGGCAGG + Intergenic
1116627711 14:47287279-47287301 GTTAGCAAAGAGGAAGGGGTGGG + Intronic
1117041858 14:51775278-51775300 CTGAGCAATGAGGAGGATGGAGG + Intergenic
1117450998 14:55849913-55849935 GTGAGGAAGGAGGTGGTGGTAGG - Intergenic
1117733525 14:58747197-58747219 ATGAGCAGTGGGGAGGTCGTGGG + Intergenic
1118681438 14:68245782-68245804 CGGAGCAATGAGGTGGAGGTAGG + Intronic
1118858556 14:69643600-69643622 GTGAGCAAACAGCAGGTGCTTGG + Intronic
1119557656 14:75566067-75566089 GTGAGGGATGAGGAGGAGGCAGG - Intergenic
1119894184 14:78205993-78206015 TTGAGCAATTGGGAGGTTGTGGG + Intergenic
1120153609 14:81065478-81065500 GTGAGCAATAAGAAGAGGGTTGG + Intronic
1121456698 14:94043095-94043117 GTGAGGAGGGAGAAGGTGGTGGG - Intronic
1122750387 14:103928567-103928589 GTGACCAATGTGGAGCTGCTGGG + Exonic
1123106609 14:105844771-105844793 CTGAGGAATGAGCAGGTGGGTGG + Intergenic
1124252635 15:28117038-28117060 GTGAGGAAGGAGGAGGCTGTCGG + Exonic
1125608822 15:40957482-40957504 CTGGGCAATGAGGAGGAGGCTGG - Intergenic
1125885333 15:43225390-43225412 GAGAGCAATGGGGAGGTTGTGGG + Intergenic
1126801646 15:52303480-52303502 GTGAGCCATGAGTAGGGGCTGGG + Intergenic
1127005055 15:54559540-54559562 GTGAGCAATGAGGAGGTGGTTGG + Intronic
1127278558 15:57469149-57469171 GGGAGGAATGAGCAGGTAGTAGG + Intronic
1128525134 15:68407202-68407224 GTGCCCAGTGAGGGGGTGGTGGG + Intronic
1128756919 15:70189543-70189565 GTGGGCTATGAGGAGATGGGAGG + Intergenic
1129039906 15:72676800-72676822 GTTAGGAATGGGGAGGTGGTGGG + Intronic
1129248597 15:74295595-74295617 GTGAGCAAGGGGCAGATGGTAGG + Intronic
1129423726 15:75450829-75450851 CTTGGCAATGAGGAGGTGCTAGG - Intronic
1129430561 15:75498379-75498401 GTTAGGAATGGGGAGGTGGTGGG + Intronic
1130787861 15:87120149-87120171 GTAAGCAATCAGTCGGTGGTAGG + Intergenic
1131692438 15:94841735-94841757 GTGAGCAATGAGCAAGTGGAAGG - Intergenic
1134562469 16:15222498-15222520 TTGAACAATGAGGAAGTGATAGG - Intergenic
1134743770 16:16571823-16571845 TTGATCACTGAGGAGGTAGTGGG + Intergenic
1134923011 16:18134125-18134147 TTGAACAATGAGGAAGTGATTGG - Intergenic
1135001712 16:18781928-18781950 TTGATCACTGAGGAGGTAGTGGG - Exonic
1135066565 16:19314982-19315004 GAGAGGAAGGAGGAGGGGGTGGG + Intronic
1136535900 16:30899361-30899383 GTGATCAATGAGCAGGAGGTTGG + Intronic
1136865868 16:33752733-33752755 GTGAGCCATGATGATGTTGTTGG - Intergenic
1137603088 16:49769749-49769771 GTGTGAAATGAGGTGGTGGGGGG - Intronic
1138443815 16:57050712-57050734 CTGAACAATGATGAGCTGGTTGG + Intronic
1139659709 16:68412189-68412211 ATGAGGAATGAGCAGTTGGTGGG + Intronic
1139940296 16:70600808-70600830 GGGAGAAATGAGGAGATGCTAGG + Intronic
1139954029 16:70684965-70684987 GTGAGGAATGAATGGGTGGTTGG + Intronic
1140189757 16:72805338-72805360 GTGAGCAATGCCAAGGCGGTAGG - Intronic
1141051305 16:80767066-80767088 GTGAGCAATGTGCAGGTTCTGGG - Intronic
1141631330 16:85289647-85289669 GTAAGCAACGGGGTGGTGGTGGG + Intergenic
1141753895 16:85978593-85978615 GTGACAATTGAGGAAGTGGTGGG - Intergenic
1142066925 16:88068020-88068042 GTGTGTGATGAGGAGGTGCTTGG + Intronic
1203106286 16_KI270728v1_random:1363370-1363392 GTGAGCCATGATGATGTTGTTGG + Intergenic
1203127228 16_KI270728v1_random:1598998-1599020 GTGAGCCATGATGATGTTGTTGG - Intergenic
1143593865 17:7902564-7902586 GTCTGCAATAATGAGGTGGTGGG - Intronic
1143779662 17:9222580-9222602 GTGAGGAAAGAGGAGGAGGGAGG + Intronic
1145019229 17:19416630-19416652 GGGAGCACTGATGAGGTGCTGGG + Exonic
1146034130 17:29390926-29390948 GTGAGGAGTGAGGAGGAGGAGGG - Exonic
1146836194 17:36112812-36112834 GTGACCCATGAGGAGGTGCATGG + Intergenic
1146850620 17:36218665-36218687 GTGATCCATGAGGAGGTGCACGG + Intronic
1147256834 17:39186600-39186622 GTGAGCAAAGAGGTGGGCGTGGG + Intronic
1147387387 17:40090442-40090464 GTGTGGAAGGAGGAGGTGGATGG - Intronic
1151436846 17:74102957-74102979 GTGGGCAGGAAGGAGGTGGTAGG - Intergenic
1151624373 17:75267533-75267555 TTGAGCAAGGAGGAGGAGGTGGG - Exonic
1151778621 17:76226766-76226788 CTGAGCAACGAGGTGTTGGTGGG - Intronic
1152469013 17:80480740-80480762 GTGAGCAATGGGTGGGTGCTGGG + Intergenic
1152769397 17:82157972-82157994 GTGAGGAATGAGGCAGTGGCTGG + Intronic
1156353510 18:36321863-36321885 GTGAGTCATGAGGAGGGCGTGGG + Intronic
1159598497 18:70406224-70406246 GTGAGAAATGGGGAGATGGAGGG + Intergenic
1161366080 19:3880624-3880646 GTGTGCAGGGAGGAGGGGGTGGG - Exonic
1162183296 19:8885622-8885644 GTGAGCAATTGTGATGTGGTTGG - Intronic
1162391023 19:10390300-10390322 GTGGGGAATGAGGAGGAGGCTGG + Intergenic
1162393212 19:10402274-10402296 GTGAGCACTGAGAGGGTGGTGGG + Intronic
1162418354 19:10551981-10552003 GGGAGGAGTGAGGAGGGGGTGGG - Intronic
1162922599 19:13912439-13912461 GTGAGCACTGAGGGCGGGGTGGG + Intronic
1163514249 19:17753587-17753609 GTGAGCAAGTAGGAGGTCTTGGG + Intronic
1164896845 19:31884143-31884165 GTGAGTAATGAGGAAGAGGGAGG - Intergenic
1165125494 19:33593379-33593401 GTGAGGAAGGAGTTGGTGGTGGG - Intergenic
1165821184 19:38677102-38677124 CTGAAGAATGAGGAGGAGGTAGG - Intronic
1165882566 19:39053974-39053996 GTGAGCAAGGAGGCTGTGGGAGG - Intergenic
1166348736 19:42183670-42183692 GGGAGCCAAGAGGAGGTGGATGG + Intronic
1166351382 19:42200012-42200034 TGGAGCAGTGAGGAGGTGGTGGG - Intronic
1167012221 19:46816186-46816208 CTGAGCACACAGGAGGTGGTCGG + Intergenic
1167702056 19:51054635-51054657 GTGAGCAAGGAGGAGAGGGTGGG - Intergenic
1167842256 19:52131629-52131651 GTGAGCTAAGGGGAGGAGGTTGG + Intronic
1168219828 19:54952648-54952670 CTGAGGAATGAGGAGATGGGAGG - Intronic
925296536 2:2780928-2780950 GTGAATCCTGAGGAGGTGGTGGG - Intergenic
925329686 2:3048854-3048876 GTGGGCCATGAGGAGCAGGTGGG + Intergenic
925525055 2:4790688-4790710 GTGAGCAATGCGAAGGAGATGGG - Intergenic
926442686 2:12906934-12906956 GTGGGGAATGGGGAAGTGGTGGG - Intergenic
927137177 2:20105513-20105535 GAGAGCAATGAGGAGTGGGCAGG - Intergenic
927852753 2:26510506-26510528 GTGAGGGATGAGGAGGGGTTAGG - Intronic
928171492 2:29007347-29007369 GACAGCAATGAGGAGGTCTTGGG - Intronic
928436921 2:31260783-31260805 GTCAGGGATGAGGAGGGGGTGGG - Exonic
929336252 2:40749947-40749969 GGAAGCAGTGAAGAGGTGGTAGG + Intergenic
929423261 2:41816798-41816820 GTGTACAATGAGGAGGTTGTGGG - Intergenic
930002951 2:46873588-46873610 CTGTGCAATGGGGTGGTGGTGGG - Intergenic
931568126 2:63638148-63638170 GTGGGAAATGAAGAGATGGTGGG + Intronic
932816643 2:74867071-74867093 GAAAGCACTGAGGAGGTAGTCGG + Intronic
933207809 2:79529197-79529219 ATGAGGCATGAGAAGGTGGTAGG + Intronic
933703515 2:85273149-85273171 GTGAGTGAGGAGGAGGTGGGAGG - Intronic
934704721 2:96469083-96469105 CTCATCAATGAGGAGGTGGGTGG - Intergenic
935135342 2:100295625-100295647 GTGAACAAGGAGGTGGTGGGTGG + Intronic
935544531 2:104386880-104386902 CTGGGCAGTGAGGAGGTGGCTGG - Intergenic
937857752 2:126684824-126684846 ATGAGCATTGACGAGGTGCTAGG - Intronic
937950019 2:127377513-127377535 ATGAGCAATGTGGAGGCAGTGGG + Intronic
938140940 2:128794164-128794186 ATGAGGACTGGGGAGGTGGTTGG - Intergenic
938376166 2:130808194-130808216 GAGAGCCAGGAGGAGGTGGCAGG + Intergenic
938653567 2:133408456-133408478 GTCAGCAATGTAGAGGGGGTAGG - Intronic
939921665 2:148122998-148123020 GTGAGCAATGAAGAGGTGGGTGG + Intronic
940718476 2:157256098-157256120 GTGAGGGATGTGGAGGTTGTGGG + Intergenic
943329933 2:186547001-186547023 CTGAGGAATGAGTGGGTGGTAGG - Intergenic
945468563 2:210200440-210200462 GTCAGGAATGAGGTGGAGGTGGG - Intronic
945842732 2:214907198-214907220 GACAGCAATGAGGTGGTGATGGG + Intergenic
946088163 2:217195406-217195428 GTGATCATGGAGGAGGTGGGTGG - Intergenic
946710527 2:222500375-222500397 GGGAGCAATGAGGAGTAAGTGGG + Intronic
948285541 2:236781885-236781907 TTCAGCAATGATGAGGTGCTGGG - Intergenic
948478804 2:238238127-238238149 GTGAGCAGTGTGATGGTGGTGGG - Intergenic
949044014 2:241862373-241862395 GTGAGGAAGGAGCAGGCGGTGGG - Intergenic
1169555882 20:6749348-6749370 GGGTGCATTTAGGAGGTGGTGGG - Intergenic
1169715136 20:8607446-8607468 GTGATCTGTGATGAGGTGGTTGG - Intronic
1170930568 20:20766602-20766624 GTGAGCACTGGGTAGGTGGGTGG + Intergenic
1171275358 20:23852188-23852210 GTGAAAACTGAGGGGGTGGTAGG - Intergenic
1171725889 20:28620601-28620623 GAGATCCATGAGGAGGAGGTGGG + Intergenic
1172035752 20:32009974-32009996 GTGAGAAATGAAAAGGTGGATGG - Intergenic
1172054166 20:32142604-32142626 GTGGGCCATGAGAAGTTGGTGGG + Intronic
1172068489 20:32238879-32238901 GTGAGGAATGCGGAGGTGAAGGG - Intergenic
1172294459 20:33798785-33798807 GTGAGGAGTGAGGGGGAGGTGGG - Intergenic
1172658044 20:36548920-36548942 CTGAGGAATGAGGACGTGGCAGG - Intronic
1172937492 20:38630758-38630780 GCGGGCACTGAGGGGGTGGTGGG - Intronic
1173657721 20:44711873-44711895 GGGAGAAATGAGGAGGTGTGAGG - Intergenic
1173863499 20:46299228-46299250 ATGAGCAAAGAGGAGGAGCTTGG - Intronic
1174602271 20:51734332-51734354 TTGGGCACTGAGGAGGTGATTGG - Intronic
1175491571 20:59384007-59384029 GTGAGCGGGGAGGAGGTGGAGGG + Intergenic
1175491609 20:59384125-59384147 GTGAGCAGGGAGGAGGTGAGTGG + Intergenic
1175665217 20:60852876-60852898 GAGAGGAATAAGGAGGTTGTTGG + Intergenic
1175723877 20:61303703-61303725 GGGAGCAGGGAGGAGGAGGTAGG + Intronic
1176735313 21:10540739-10540761 GTGAAAAGTGAGGAGGTGATTGG + Intronic
1176894565 21:14361413-14361435 GTGATCAAAGAAGGGGTGGTGGG - Intergenic
1179393050 21:41011235-41011257 GTGACCACTGAGGAGGATGTGGG + Intergenic
1179451987 21:41473931-41473953 GTGAGGAGTGAGGAGGTGAGGGG + Intronic
1179708225 21:43194668-43194690 CTGAGAAATGAGGAGGGGGGAGG - Intergenic
1180068637 21:45425157-45425179 GTGAGGAAGGAGGCGGTGGGTGG - Intronic
1180186112 21:46140162-46140184 GTGAGCAATGTGAAGGTGGACGG - Intronic
1180186131 21:46140262-46140284 GTGAACAATGTGAAGGTGGACGG - Intronic
1180186142 21:46140312-46140334 CTGAGCAATGCGAAGGTGGACGG - Intronic
1180186183 21:46140513-46140535 CTGAGCAATGCGAAGGTGGACGG - Intronic
1181346073 22:22221513-22221535 GGGAGCAATGAGGACGAGGAAGG - Intergenic
1181440320 22:22932308-22932330 GGGAGCTGTGAGGAGGGGGTAGG - Intergenic
1181465145 22:23106918-23106940 GTGTGCAGTGTGGAGGGGGTGGG - Intronic
1182847044 22:33439895-33439917 GTGAGGAATGAGGAGCAGGAGGG - Intronic
1183470755 22:38005180-38005202 GTGAGCACTCAGGAAGTGGTAGG + Intronic
1183533773 22:38382332-38382354 GTGAAAAGTGAGGAGGTGATTGG - Intronic
1183901557 22:41009717-41009739 GTGGGCAATGGGGAGCTGCTGGG + Intergenic
1184660831 22:45964792-45964814 CTGAGCACTGAGGAGGAGGCAGG + Intronic
1184825548 22:46948338-46948360 GTGAGCAGTCAAGAGTTGGTGGG - Intronic
1184849620 22:47112759-47112781 GGGAGCATTGAGGCGGTGATTGG + Intronic
1185043447 22:48517413-48517435 GTGTCCCAGGAGGAGGTGGTGGG - Intronic
949356600 3:3187055-3187077 CAGAGCAATGAGCAGTTGGTAGG + Intergenic
950892002 3:16412536-16412558 GTGGGGAGTGAGGTGGTGGTGGG + Intronic
953907236 3:46874506-46874528 GCCAGGAAGGAGGAGGTGGTGGG - Intronic
954689006 3:52385990-52386012 GTGAGCACTCAGGAGGTGGAAGG + Intronic
954827497 3:53387093-53387115 GTGGCCACTGAGGAGGTGGCTGG - Intergenic
955195233 3:56799927-56799949 GTGAGAAATAAGGAAGGGGTTGG - Intronic
955291231 3:57693963-57693985 CTAAGAAAGGAGGAGGTGGTAGG - Intergenic
955463902 3:59216115-59216137 GTGGGAGATGAGGATGTGGTGGG + Intergenic
956580660 3:70808540-70808562 GAGGGTACTGAGGAGGTGGTGGG + Intergenic
957939552 3:86988734-86988756 GTGAGCCATAGGGAGGTGCTTGG - Intronic
958914307 3:100031409-100031431 GTGAGGAAGGAGTTGGTGGTAGG + Intronic
958921831 3:100115216-100115238 TTGAGCACTGGGCAGGTGGTAGG - Intronic
959791033 3:110361631-110361653 GGGAGCAGAGAGGAGGTGATGGG - Intergenic
961096980 3:124165900-124165922 GTGAACAAGCAGGAAGTGGTAGG - Intronic
962255965 3:133870470-133870492 GTGAACAATGCAGAGGTGGTGGG + Intronic
962608067 3:137049277-137049299 GTGTGCATGGAGGAAGTGGTGGG - Intergenic
962660110 3:137593513-137593535 GTTAGAAATAAGGTGGTGGTGGG - Intergenic
963238186 3:142975686-142975708 GTGGTCTATGAGGAGGTGATGGG + Intronic
963955601 3:151250191-151250213 ATGTGCAATGAGGAGGTCTTTGG - Intronic
964691605 3:159455857-159455879 GTGAGTAGTAAGTAGGTGGTTGG + Intronic
966597343 3:181736587-181736609 GTGAAGGATGAGGGGGTGGTTGG - Intergenic
967084106 3:186078697-186078719 GTGAGCACTGACGGGGTTGTGGG - Intronic
967151506 3:186654546-186654568 CTAAGGAATGAAGAGGTGGTGGG - Intergenic
968192240 3:196677115-196677137 GGGAGCAATGTGGAGGTGTTTGG + Intronic
968814650 4:2815576-2815598 TGGAGCCAGGAGGAGGTGGTGGG + Intronic
969044065 4:4323818-4323840 TTTAGCAATGGGGAGGTCGTGGG - Intergenic
970043447 4:11822728-11822750 GTGTGCAAGGTGGAGGTGGTTGG + Intergenic
970088665 4:12377812-12377834 TTGAGCAATGAGGAGGCAGAGGG + Intergenic
970458908 4:16253306-16253328 GTCAACAAGGAGGAGGTGATAGG - Intergenic
972360640 4:38322839-38322861 GGGGGCGATGGGGAGGTGGTGGG - Intergenic
974306074 4:60142021-60142043 TTGAGAAATGAGGAGGTTGGAGG - Intergenic
974329373 4:60457090-60457112 GTAATCTATGAAGAGGTGGTTGG - Intergenic
975912686 4:79286347-79286369 TTGAGCAATGAGGATGAGGTGGG + Intronic
978974579 4:114854106-114854128 GGAAGCAAAGTGGAGGTGGTAGG - Intronic
982211462 4:153039942-153039964 GTGAGGAAAGAGGAGGGAGTTGG + Intergenic
982396081 4:154917427-154917449 GTGAGCAAGCTGCAGGTGGTAGG - Intergenic
982445922 4:155490607-155490629 GTGAGAAATGGGGAGGTAGCAGG + Intergenic
983608920 4:169620665-169620687 ATGAGCAAGGAGGGTGTGGTGGG + Exonic
983730755 4:170991159-170991181 GTGAGCAATGAGTAGTAGATAGG + Intergenic
984604269 4:181766529-181766551 GTGAGCAGAGTGGAGGTGGCAGG + Intergenic
986088785 5:4481094-4481116 GAGTGCAAAGAGGAGGTGGACGG - Intergenic
986867964 5:12012468-12012490 TAAAGTAATGAGGAGGTGGTGGG + Intergenic
987181012 5:15368479-15368501 GTGGCCAGTGTGGAGGTGGTCGG - Intergenic
987463453 5:18243845-18243867 GTGCACAGTGAGAAGGTGGTAGG - Intergenic
987977681 5:25035751-25035773 GAGAGAAATGAGGAGATGCTGGG - Intergenic
988722962 5:33896903-33896925 GAGAGCAGTTAGGAGGTTGTTGG + Intergenic
988819143 5:34863353-34863375 GTTAGCAATGAGGATGAGGGTGG + Intronic
989174991 5:38515618-38515640 GAGAGAAATGAGGCGGTGGGGGG + Intronic
989824765 5:45839649-45839671 GTAAGGGGTGAGGAGGTGGTGGG + Intergenic
991919575 5:71642279-71642301 GGGAGGAATGAGAAGGTGGGAGG + Intronic
992352393 5:75943627-75943649 GTGAGCAATAAGGAGATAGATGG + Intergenic
992446233 5:76836732-76836754 GTGAGAAATGAGAAAATGGTGGG + Intergenic
995864953 5:116680873-116680895 GTGAGCGATGAGGAGGCTCTGGG + Intergenic
997474612 5:134135454-134135476 GCGGGCAAGGAGGAAGTGGTGGG + Intronic
997786819 5:136721150-136721172 ATGAGGAAAGAGGATGTGGTAGG + Intergenic
998508406 5:142690830-142690852 GTGAGCAATGAGTATGTTGGGGG - Intronic
999000958 5:147922404-147922426 GTGAGCAATGAGGAGCTGTGGGG + Intergenic
999439243 5:151588860-151588882 GTGAGAAATGAGGGGGTGCATGG - Intergenic
1001317173 5:170652055-170652077 CTGAGCAATGAGGAGCTGGCTGG + Intronic
1001453407 5:171843115-171843137 GTTAGCAAAGAGGAAGTGGGAGG - Intergenic
1001818421 5:174690737-174690759 GTGGGCAAGGAGGAGTTGGGAGG - Intergenic
1002700926 5:181124406-181124428 TTGAGGAATGGGGAGGTGATGGG - Exonic
1003878941 6:10463022-10463044 ATGAGCAATGTGGAGGTCATCGG + Intergenic
1003954710 6:11151013-11151035 CTGTGAAAAGAGGAGGTGGTGGG - Intergenic
1004436550 6:15600701-15600723 CTGAGAACTGAGCAGGTGGTAGG + Intronic
1005255412 6:23997610-23997632 TTGAGCAATGTGGAGGTTATGGG - Intergenic
1006147275 6:31967152-31967174 GTGAGTGCTGAGGAGGTGATAGG + Intronic
1008102196 6:47404011-47404033 GTGAGATATGAGGAGGTGGATGG - Intergenic
1008487082 6:52048030-52048052 GTGACCACAGAGGCGGTGGTTGG + Intronic
1009543560 6:64997006-64997028 GTGAGAAATGAGGAGCCGGAGGG + Intronic
1011756402 6:90502509-90502531 ATGACAAATGTGGAGGTGGTTGG - Intergenic
1012566727 6:100665247-100665269 GTGAGGAACTAGGAGGAGGTAGG + Intronic
1013432764 6:110069784-110069806 GTGAGCCAAGAGGAGAGGGTAGG - Intergenic
1013842748 6:114417666-114417688 GTGAGCAATTTTGAAGTGGTAGG + Intergenic
1015117432 6:129665084-129665106 GTGGGGAATGAAGAGGTGGGAGG - Intronic
1015425753 6:133065156-133065178 AAGAGCAATGAGGAGGTATTTGG - Intergenic
1016066258 6:139686411-139686433 GTTAGCAGGGAGGTGGTGGTGGG + Intergenic
1016154504 6:140786976-140786998 GTGAGCATTGGGGATGTGGATGG - Intergenic
1017081335 6:150671822-150671844 GTGAGCAGTGGGGATGGGGTTGG + Intronic
1017194367 6:151684222-151684244 ATGAACACTGAGGAAGTGGTGGG + Intronic
1018100536 6:160435070-160435092 CTCAGCAATGAGGTGGTTGTAGG - Intronic
1018528859 6:164742228-164742250 GGGAGGGGTGAGGAGGTGGTGGG - Intergenic
1018528917 6:164742397-164742419 GGGAGGAGTGAGGAGGTGGGAGG - Intergenic
1020434865 7:8151711-8151733 CTGAGAAATGTGGAGGTGGGTGG + Intronic
1021852876 7:24825713-24825735 GTGTGCAAGGAGGAAGTGATGGG + Intronic
1022612763 7:31893791-31893813 GTGAACAATGAGGGGTTGTTTGG - Intronic
1024040645 7:45550939-45550961 TTGGGCAATGAAGAGGTGGCTGG - Intergenic
1029289732 7:99493066-99493088 GTGAGGAATGAGGAAGTAGGGGG - Intronic
1029445113 7:100607598-100607620 GTGAGAGATGAGGAGATGGGAGG - Intronic
1029743244 7:102503092-102503114 GTGAGCAATGGGGGCGTGGCTGG + Intronic
1029761233 7:102602253-102602275 GTGAGCAATGGGGGCGTGGCTGG + Intronic
1031709995 7:125033681-125033703 GTGAGCAATGAGGAGCTGTGGGG + Intergenic
1031823568 7:126534111-126534133 GTCAGCAATGAGGAGGTAAATGG - Intronic
1032574277 7:133035664-133035686 GTGAGCAATGAGGAGCTGCGGGG - Intronic
1033499696 7:141935695-141935717 GTGAGGAATGGAGAGGTGGCTGG - Intronic
1033983968 7:147200063-147200085 GTGAGAAAGGAGGAGGGGGAGGG - Intronic
1034452617 7:151145303-151145325 GTGAGGAAAGGGGAGGAGGTAGG + Intergenic
1035096464 7:156360099-156360121 GTGAGATAAGGGGAGGTGGTTGG - Intergenic
1035286804 7:157812027-157812049 GTGAGAAATGAGGAGGTTCAGGG + Intronic
1035298975 7:157884873-157884895 AGGAGCAATGAGGAGGTGATAGG - Intronic
1035392506 7:158514600-158514622 GTGAGCACTGAGGAAGAGGTGGG - Intronic
1038024765 8:23578529-23578551 ATGAGCAGAGAGGAGGTGGCAGG - Intergenic
1038401734 8:27289049-27289071 GGGAGCTCTGAGGAGGTGGGAGG + Intronic
1040520938 8:48175602-48175624 GTGAGCAATTAGGCGGGGGCAGG + Intergenic
1041327978 8:56689385-56689407 GGGAGCATAGAGGAGGTGGATGG + Intergenic
1042716466 8:71778508-71778530 GAGAGGAATGAGGAAGGGGTAGG + Intergenic
1045042965 8:98244410-98244432 GTCTGCAATGATGAGGGGGTGGG + Intronic
1045411691 8:101926782-101926804 GTTAGGGATAAGGAGGTGGTGGG + Intronic
1047381135 8:124364354-124364376 GAGAGCACTGAGGAGGAGGGAGG + Intronic
1049504141 8:142985869-142985891 GGGGCCAATGAGGAGGTGGTTGG - Intergenic
1049544858 8:143225850-143225872 AGGAGCAAGGAGGTGGTGGTAGG + Intergenic
1049994844 9:1025139-1025161 GTGAGCATTGTGGAGGAGGCAGG + Intergenic
1051695990 9:19768354-19768376 GTTAGCAATGAAGAGGTCATTGG - Intronic
1055596868 9:77874384-77874406 GGGAGATATGAGGAGGTGGAAGG - Intronic
1056369751 9:85941648-85941670 GGGAGCAATGAGGAGCCGGCAGG - Intronic
1056766562 9:89447784-89447806 GGGAGCACTGAAGTGGTGGTGGG - Intronic
1056989745 9:91399713-91399735 GTGGGCTTTGGGGAGGTGGTCGG + Intergenic
1057561069 9:96128255-96128277 GTGAGCCATGAGGATGATGTTGG - Intergenic
1057768400 9:97943998-97944020 GTGAGCAAGGAGGAGGAGAAGGG - Intronic
1058669003 9:107344931-107344953 GTGGGGAATGAGGAGATTGTTGG + Intergenic
1058940248 9:109806786-109806808 GTGACCAAAGAGGTGGTGGCTGG + Intronic
1060234159 9:121850545-121850567 GGGAGGAGTGGGGAGGTGGTGGG + Intronic
1060678569 9:125540193-125540215 GTGAAAAATCAGAAGGTGGTAGG - Intronic
1061807263 9:133143409-133143431 GTGAGCGAGGAGGTGGTGGGAGG + Intronic
1062434942 9:136542846-136542868 GAGAATAATGAGGAGGTGTTTGG - Intronic
1186710643 X:12192487-12192509 GTGAGCTCTGATGGGGTGGTAGG + Intronic
1187377096 X:18764689-18764711 GTGAGGAAGGAGGAGGGGGCAGG + Intronic
1187559039 X:20382547-20382569 GTGGTCAAAGATGAGGTGGTGGG + Intergenic
1187637310 X:21244092-21244114 GTCAAAAATGAGGTGGTGGTAGG + Intergenic
1188727693 X:33606497-33606519 GTGAGCAATGTGGTGGGGGGGGG + Intergenic
1188877998 X:35456232-35456254 GTGAGAAAAAATGAGGTGGTTGG - Intergenic
1189718196 X:43886202-43886224 GAGGTCAATGAGAAGGTGGTAGG + Intergenic
1189726740 X:43975088-43975110 GGGAGAAATGAGAAGGTGGACGG - Intergenic
1190540511 X:51473282-51473304 GTGAGCAATTAAGAGGGGCTTGG - Intergenic
1190687563 X:52888197-52888219 GGGAGCAATGAGGTGGGGGAGGG - Intergenic
1190698419 X:52967595-52967617 GGGAGCAATGAGGTGGGGGAGGG + Intronic
1192233001 X:69278623-69278645 GTCAGCAAAGAGGAGGTGACAGG - Intergenic
1192737199 X:73861076-73861098 GTGAGCATAGATGTGGTGGTAGG + Intergenic
1193198065 X:78657377-78657399 TTGAGCAATGAGGTGGAAGTGGG + Exonic
1195002366 X:100654294-100654316 GTTAGCAATGATGAGGGGGAGGG + Intronic
1195045649 X:101052130-101052152 GTGAGGAAAGAGCAGGTGGTGGG - Intergenic
1196439194 X:115703045-115703067 GTGAGCAATGAGGAGCTGCAGGG + Intergenic
1196501320 X:116386420-116386442 TTGAACAATGTGGAGGTTGTGGG + Intergenic
1197022509 X:121708790-121708812 GGGCGCAATAAGTAGGTGGTGGG - Intergenic
1197372170 X:125638797-125638819 GTGCACAATGGGGATGTGGTGGG + Intergenic
1197757113 X:130003085-130003107 GAGACCAGTGTGGAGGTGGTAGG - Intronic
1198134343 X:133732651-133732673 GCCAGAAATTAGGAGGTGGTAGG - Intronic
1198714177 X:139538792-139538814 GTGAGCAATGAAGGGATTGTAGG - Intronic
1199265077 X:145819107-145819129 GAGAGAAAGGTGGAGGTGGTTGG - Exonic
1202593314 Y:26510263-26510285 GTGAAAAGTGAGGAGGTGATTGG + Intergenic
1202593673 Y:26513682-26513704 GTGAAAAGTGAGGAGGTGATTGG + Intergenic