ID: 1127007324

View in Genome Browser
Species Human (GRCh38)
Location 15:54585015-54585037
Sequence AACCAATGGTAGTCTGGTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 93}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127007324_1127007330 5 Left 1127007324 15:54585015-54585037 CCATCACCAGACTACCATTGGTT 0: 1
1: 0
2: 0
3: 7
4: 93
Right 1127007330 15:54585043-54585065 ATATGGGCAGCAGAATTAAGAGG 0: 1
1: 0
2: 0
3: 6
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127007324 Original CRISPR AACCAATGGTAGTCTGGTGA TGG (reversed) Intronic
905444335 1:38015622-38015644 AACAAATGGTAGTATGTAGAAGG + Intronic
905475045 1:38220070-38220092 AATCAATGGTGTTCTGGTGGGGG - Intergenic
905770904 1:40637210-40637232 ACCCAATGGTGGGCTGGGGAGGG + Intronic
905945862 1:41901011-41901033 AAGCAATGGTGGCCTGGAGAGGG + Intronic
905982556 1:42242969-42242991 ATCCACTGTTAGTCTGATGAAGG - Intronic
918690875 1:187477868-187477890 AATCAATGGTAGTCCAGTTAGGG - Intergenic
919186860 1:194162119-194162141 AACTCATGCTAGTCTGGAGATGG - Intergenic
1066072249 10:31829802-31829824 TACAAATGGTAGTTTGTTGAGGG - Intronic
1068447486 10:57140960-57140982 AACAAAAGGTAGACTTGTGATGG + Intergenic
1070824947 10:79385612-79385634 AACCTAAGGCAGTCTGGTGGGGG + Exonic
1071598341 10:86943718-86943740 GACCAATGGCAGTCTGGTGTTGG - Exonic
1079186669 11:18244464-18244486 ATCCAATGTCAGTCTTGTGAGGG + Intronic
1084237650 11:67798377-67798399 AAACAATGGAATTCTGGTGATGG + Intergenic
1094122781 12:26991592-26991614 AAACAATGGTAGTCTGATGTAGG - Intronic
1095614691 12:44174241-44174263 AAACAATGGTAGGCTGGATATGG - Intronic
1097277721 12:57824501-57824523 ATCCATTGGAAGCCTGGTGAGGG - Intronic
1102012229 12:109625805-109625827 ATCCAAGGGTGGTCTCGTGAGGG - Intergenic
1106312963 13:28569773-28569795 AACCAATGGGAGTAGGGGGAGGG - Intergenic
1106361423 13:29034812-29034834 CAGCAATGGTAGCTTGGTGAAGG - Intronic
1106969211 13:35116250-35116272 AACCATTGGTATGCTGGTAAAGG - Intronic
1113835429 13:113325681-113325703 AACCAAAGGGAGTTTCGTGATGG - Exonic
1115803814 14:37028460-37028482 AATCAATGGTAGGTTGGTGATGG + Intronic
1117284924 14:54277988-54278010 CACCAATGGTATTATTGTGAGGG + Intergenic
1117703873 14:58442618-58442640 AACAAATGGTAATCTGCCGAAGG - Intronic
1127007324 15:54585015-54585037 AACCAATGGTAGTCTGGTGATGG - Intronic
1128561153 15:68668625-68668647 AGCCAATGGTAGTCAGGGGCTGG + Intronic
1130248713 15:82280275-82280297 AACCAAAGCTGGTTTGGTGAGGG + Intronic
1130451342 15:84055876-84055898 AACCAAAGCTGGTTTGGTGAGGG - Intergenic
1135004883 16:18811493-18811515 AACTAACTGTAGTCTGGTGGAGG + Intronic
1137318944 16:47358854-47358876 CACCAATGGAGTTCTGGTGAGGG + Intronic
1148083752 17:44981860-44981882 AGTCAATGGTACCCTGGTGATGG - Intergenic
1148734750 17:49859042-49859064 AACCGAAGGAAGTCTGGGGAGGG - Intergenic
1153233406 18:2962379-2962401 AAACAATTATAATCTGGTGATGG + Intronic
1153247568 18:3088098-3088120 AACCAAGGGCAGTCTGGAAATGG - Intronic
1153281600 18:3419641-3419663 CACCAAGGGTAGTCCAGTGATGG - Intronic
1155287989 18:24311018-24311040 AACCAGAGGTAGTATGGTAAAGG + Intronic
1155629723 18:27878270-27878292 CACCAATGGTAGACTGGAAAAGG - Intergenic
1155704642 18:28793650-28793672 AACCAATGATTGTGAGGTGAAGG + Intergenic
1159007419 18:63025123-63025145 AAACAATGGGTGTCTGGTGGGGG + Intergenic
1164925051 19:32124037-32124059 AACCCAGGGTAGACTGATGAGGG + Intergenic
1166618425 19:44272442-44272464 AACCAATGATAGTCTGGGTGCGG + Intronic
926106745 2:10156966-10156988 AATCAATGGTAGTGTGTTGGAGG + Intronic
929499852 2:42481165-42481187 GACCAATGGGAGTCTGGAGCTGG - Intronic
931097196 2:58954578-58954600 AACCACTCGTTGTCTGATGAAGG + Intergenic
931580540 2:63767014-63767036 AATCAGTGGTTGTCTGGGGATGG - Intronic
937379380 2:121362827-121362849 AGCCTCTGGTAGTCTGGTGTGGG - Intronic
941104589 2:161338823-161338845 AATCAGTGGTAGTCTGGGGGTGG - Intronic
944069154 2:195650796-195650818 AACCAATACAACTCTGGTGAGGG - Intronic
944753631 2:202736982-202737004 AGCCAATGCTAGGCTGCTGATGG + Intronic
1179494128 21:41761003-41761025 AGCCGATGGTATGCTGGTGATGG - Intronic
1180348355 22:11723739-11723761 AAACATTGGTATACTGGTGAAGG - Intergenic
1182471193 22:30549382-30549404 CACCAAAGGTAGTCTGGCAATGG + Intergenic
1185023472 22:48394204-48394226 AGCCAATGGGTGTCTGGTGCCGG - Intergenic
949142458 3:651301-651323 AACCAAAGGTAGTCTGTTATTGG + Intergenic
949962163 3:9321461-9321483 AACCGATAGTTGTCTGGAGAAGG + Intronic
950772627 3:15324319-15324341 AAGCAATTGTAGTGGGGTGAGGG - Intronic
951955711 3:28251000-28251022 AACCAGAGACAGTCTGGTGAAGG + Intronic
957940497 3:86996970-86996992 ATACAATGGTAGGATGGTGAAGG + Intergenic
962747443 3:138407556-138407578 AGCCAATGGAAGTCTCATGAGGG - Intergenic
967051311 3:185787096-185787118 AACCATTTGTAGAATGGTGATGG + Intronic
967466511 3:189812520-189812542 AAAGAATGGTAGTGTGGAGATGG + Intronic
968428742 4:540753-540775 AACAAATGTTAGTTTGCTGAAGG + Intergenic
970221750 4:13818888-13818910 ACCCAATGGGAATGTGGTGAAGG - Intergenic
980793626 4:137652525-137652547 AACCAATGGGAGGGTGGTGGTGG - Intergenic
984088385 4:175340259-175340281 TAACAATGGTTGTCTTGTGATGG + Intergenic
984186169 4:176546273-176546295 AACCAGTGGCATCCTGGTGAGGG - Intergenic
984194798 4:176646148-176646170 AACCAATGGCTCTCTGGAGATGG - Intergenic
989392429 5:40915210-40915232 ATCCAGTTGGAGTCTGGTGATGG - Intronic
990499940 5:56386005-56386027 AACCAAAGATCGTCTGGTGAAGG - Intergenic
993316876 5:86419243-86419265 AACCAATGTTAGGTTGGTCATGG - Intergenic
997863836 5:137443675-137443697 AACCCATGGCTGTCTGGAGAGGG - Intronic
1000031283 5:157403684-157403706 ATCCACTGTTAGTCTGATGAGGG - Intronic
1001776143 5:174330489-174330511 AACCAATCATAGTGTAGTGAAGG + Intergenic
1004420424 6:15464616-15464638 AACTAAGGGTACTCTGGTGGTGG + Intronic
1004687703 6:17963093-17963115 GACCAATGGAAGTGAGGTGAGGG + Intronic
1006340433 6:33443651-33443673 GACCAATGGTGATCTGGGGAGGG - Exonic
1007087749 6:39161567-39161589 AACAAATGGTAGGCTGGGCATGG + Intergenic
1011183605 6:84649737-84649759 AACAATTGGGTGTCTGGTGAGGG - Intergenic
1015484893 6:133758110-133758132 AACAAAGGGTAGATTGGTGAGGG + Intergenic
1022110128 7:27225127-27225149 CACCAATGGTTTTCGGGTGACGG + Intergenic
1026465266 7:70648247-70648269 AAACTGTGGTAGTCTGGTGGTGG - Intronic
1027381745 7:77617867-77617889 AACCAAGGATATTCTGGGGATGG + Intronic
1028311865 7:89348369-89348391 AAGTAAAGGTAGTCTTGTGAAGG + Intergenic
1032728161 7:134611487-134611509 AACCAATGGTATTCTGGGGTTGG + Intergenic
1036088421 8:5638284-5638306 AACCCATGGGACTCTGGGGATGG + Intergenic
1047467703 8:125134100-125134122 AAGCAATCATATTCTGGTGAGGG + Intronic
1051441452 9:17087564-17087586 CAACAATGGTAGTTTGGTTAAGG - Intergenic
1185745247 X:2567338-2567360 AATCAATGGTAATCTGATGAAGG + Intergenic
1187174547 X:16884385-16884407 AACCAATGCTAGGCTGGGTAAGG + Intergenic
1193504926 X:82330420-82330442 AACTCACGGTAGTGTGGTGATGG - Intergenic
1194412697 X:93577051-93577073 CAGTAATGGTAGTCTGGGGAAGG - Intergenic
1195647265 X:107246581-107246603 AACCAAACCTAGTCTGGGGAGGG + Intergenic
1195899343 X:109781194-109781216 AACCAATGGAATCCTGGAGAGGG + Intergenic
1196998733 X:121414606-121414628 ATCCACTGTTAGTCTGATGAGGG + Intergenic
1197258107 X:124286216-124286238 AACCCAGGGAACTCTGGTGATGG + Intronic
1198759515 X:140017179-140017201 ATCCAATGGTAGTCTTGGGGTGG - Intergenic
1200870197 Y:8089492-8089514 ATCCAAAGGGGGTCTGGTGATGG - Intergenic
1202269971 Y:23061883-23061905 ATCCAATGACAGTCTGGAGAAGG + Intergenic
1202296056 Y:23358799-23358821 ATCCAATGACAGTCTGGAGAAGG - Intergenic
1202422965 Y:24695628-24695650 ATCCAATGACAGTCTGGAGAAGG + Intergenic
1202447824 Y:24974458-24974480 ATCCAATGACAGTCTGGAGAAGG - Intergenic