ID: 1127013413

View in Genome Browser
Species Human (GRCh38)
Location 15:54655537-54655559
Sequence TTGGGGGTCTGGGGATCAGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127013413_1127013421 9 Left 1127013413 15:54655537-54655559 CCGTCTGATCCCCAGACCCCCAA No data
Right 1127013421 15:54655569-54655591 ACGAGCATAGACCACTTCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127013413 Original CRISPR TTGGGGGTCTGGGGATCAGA CGG (reversed) Intergenic
No off target data available for this crispr