ID: 1127013905

View in Genome Browser
Species Human (GRCh38)
Location 15:54661191-54661213
Sequence TAGACACTTTCCCATGGGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127013905_1127013909 -8 Left 1127013905 15:54661191-54661213 CCATTCCCATGGGAAAGTGTCTA No data
Right 1127013909 15:54661206-54661228 AGTGTCTAGGAAACCACATCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127013905 Original CRISPR TAGACACTTTCCCATGGGAA TGG (reversed) Intergenic
No off target data available for this crispr