ID: 1127018124

View in Genome Browser
Species Human (GRCh38)
Location 15:54711770-54711792
Sequence CTCATTAGGTGGCACGATGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127018124_1127018132 14 Left 1127018124 15:54711770-54711792 CCGGCATCGTGCCACCTAATGAG No data
Right 1127018132 15:54711807-54711829 CCACATGAAGTAGAATAGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127018124 Original CRISPR CTCATTAGGTGGCACGATGC CGG (reversed) Intergenic
No off target data available for this crispr