ID: 1127026013

View in Genome Browser
Species Human (GRCh38)
Location 15:54807552-54807574
Sequence ATTTCTAAGAGGTAACTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127026006_1127026013 25 Left 1127026006 15:54807504-54807526 CCTCTTCTTGGGGTGAAAGGGAG No data
Right 1127026013 15:54807552-54807574 ATTTCTAAGAGGTAACTGGATGG No data
1127026003_1127026013 30 Left 1127026003 15:54807499-54807521 CCAAGCCTCTTCTTGGGGTGAAA No data
Right 1127026013 15:54807552-54807574 ATTTCTAAGAGGTAACTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127026013 Original CRISPR ATTTCTAAGAGGTAACTGGA TGG Intergenic
No off target data available for this crispr