ID: 1127026721

View in Genome Browser
Species Human (GRCh38)
Location 15:54815112-54815134
Sequence CAGGGTACAGCCCCTGTAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127026721_1127026723 -10 Left 1127026721 15:54815112-54815134 CCAGCTACAGGGGCTGTACCCTG No data
Right 1127026723 15:54815125-54815147 CTGTACCCTGCAAAACCACAGGG 0: 49
1: 1004
2: 1546
3: 1300
4: 1075
1127026721_1127026728 12 Left 1127026721 15:54815112-54815134 CCAGCTACAGGGGCTGTACCCTG No data
Right 1127026728 15:54815147-54815169 GATGGAGTTGCCCAATGTTATGG No data
1127026721_1127026724 -6 Left 1127026721 15:54815112-54815134 CCAGCTACAGGGGCTGTACCCTG No data
Right 1127026724 15:54815129-54815151 ACCCTGCAAAACCACAGGGATGG No data
1127026721_1127026729 13 Left 1127026721 15:54815112-54815134 CCAGCTACAGGGGCTGTACCCTG No data
Right 1127026729 15:54815148-54815170 ATGGAGTTGCCCAATGTTATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127026721 Original CRISPR CAGGGTACAGCCCCTGTAGC TGG (reversed) Intergenic
No off target data available for this crispr