ID: 1127032634

View in Genome Browser
Species Human (GRCh38)
Location 15:54880779-54880801
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127032634_1127032638 4 Left 1127032634 15:54880779-54880801 CCGGTTTACCTCTACTAAGACAG No data
Right 1127032638 15:54880806-54880828 TCTCTAGGAGAGCCCCAAGCAGG No data
1127032634_1127032643 27 Left 1127032634 15:54880779-54880801 CCGGTTTACCTCTACTAAGACAG No data
Right 1127032643 15:54880829-54880851 AAAGAAGTTAGGTTCAGATGTGG No data
1127032634_1127032640 16 Left 1127032634 15:54880779-54880801 CCGGTTTACCTCTACTAAGACAG No data
Right 1127032640 15:54880818-54880840 CCCCAAGCAGGAAAGAAGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127032634 Original CRISPR CTGTCTTAGTAGAGGTAAAC CGG (reversed) Intergenic
No off target data available for this crispr