ID: 1127033082

View in Genome Browser
Species Human (GRCh38)
Location 15:54885594-54885616
Sequence AATAACTAAAAGAGTATAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127033082_1127033083 -7 Left 1127033082 15:54885594-54885616 CCACTTATACTCTTTTAGTTATT No data
Right 1127033083 15:54885610-54885632 AGTTATTTTTAAGTGTGCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127033082 Original CRISPR AATAACTAAAAGAGTATAAG TGG (reversed) Intergenic
No off target data available for this crispr