ID: 1127041554

View in Genome Browser
Species Human (GRCh38)
Location 15:54982548-54982570
Sequence CATGATTAGATGGGCACCGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127041554_1127041559 3 Left 1127041554 15:54982548-54982570 CCCACGGTGCCCATCTAATCATG No data
Right 1127041559 15:54982574-54982596 AAAACATCAAATTCCATTAGAGG No data
1127041554_1127041561 5 Left 1127041554 15:54982548-54982570 CCCACGGTGCCCATCTAATCATG No data
Right 1127041561 15:54982576-54982598 AACATCAAATTCCATTAGAGGGG No data
1127041554_1127041560 4 Left 1127041554 15:54982548-54982570 CCCACGGTGCCCATCTAATCATG No data
Right 1127041560 15:54982575-54982597 AAACATCAAATTCCATTAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127041554 Original CRISPR CATGATTAGATGGGCACCGT GGG (reversed) Intergenic
No off target data available for this crispr