ID: 1127041686

View in Genome Browser
Species Human (GRCh38)
Location 15:54984019-54984041
Sequence CCAGATCACCAAATCCAAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127041683_1127041686 -4 Left 1127041683 15:54984000-54984022 CCTCTTCAAAGATGTCTACCCAG No data
Right 1127041686 15:54984019-54984041 CCAGATCACCAAATCCAAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127041686 Original CRISPR CCAGATCACCAAATCCAAAG TGG Intergenic
No off target data available for this crispr