ID: 1127045252

View in Genome Browser
Species Human (GRCh38)
Location 15:55018360-55018382
Sequence TAGGAGGACCACTTGAGTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127045252_1127045256 -1 Left 1127045252 15:55018360-55018382 CCTCAACTCAAGTGGTCCTCCTA No data
Right 1127045256 15:55018382-55018404 ACCTCGGCCTCCCAAAGTGCTGG 0: 34548
1: 173488
2: 252592
3: 176597
4: 112373
1127045252_1127045258 0 Left 1127045252 15:55018360-55018382 CCTCAACTCAAGTGGTCCTCCTA No data
Right 1127045258 15:55018383-55018405 CCTCGGCCTCCCAAAGTGCTGGG 0: 120847
1: 270445
2: 211583
3: 123288
4: 170743
1127045252_1127045260 8 Left 1127045252 15:55018360-55018382 CCTCAACTCAAGTGGTCCTCCTA No data
Right 1127045260 15:55018391-55018413 TCCCAAAGTGCTGGGATTACAGG 0: 284556
1: 262309
2: 153276
3: 130613
4: 189623

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127045252 Original CRISPR TAGGAGGACCACTTGAGTTG AGG (reversed) Intergenic
No off target data available for this crispr