ID: 1127046595

View in Genome Browser
Species Human (GRCh38)
Location 15:55032495-55032517
Sequence TAGCAGCACGTAAGGCAACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127046588_1127046595 26 Left 1127046588 15:55032446-55032468 CCCTCATTCTCACAGAGATGCAG No data
Right 1127046595 15:55032495-55032517 TAGCAGCACGTAAGGCAACAGGG No data
1127046589_1127046595 25 Left 1127046589 15:55032447-55032469 CCTCATTCTCACAGAGATGCAGA No data
Right 1127046595 15:55032495-55032517 TAGCAGCACGTAAGGCAACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127046595 Original CRISPR TAGCAGCACGTAAGGCAACA GGG Intergenic
No off target data available for this crispr