ID: 1127046727

View in Genome Browser
Species Human (GRCh38)
Location 15:55033689-55033711
Sequence TAACCTCAGCCCGGCTTCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127046720_1127046727 24 Left 1127046720 15:55033642-55033664 CCAATGACCCTACGGAGGTGTGG No data
Right 1127046727 15:55033689-55033711 TAACCTCAGCCCGGCTTCTCTGG No data
1127046722_1127046727 17 Left 1127046722 15:55033649-55033671 CCCTACGGAGGTGTGGTTTTGCA No data
Right 1127046727 15:55033689-55033711 TAACCTCAGCCCGGCTTCTCTGG No data
1127046723_1127046727 16 Left 1127046723 15:55033650-55033672 CCTACGGAGGTGTGGTTTTGCAC No data
Right 1127046727 15:55033689-55033711 TAACCTCAGCCCGGCTTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127046727 Original CRISPR TAACCTCAGCCCGGCTTCTC TGG Intergenic
No off target data available for this crispr