ID: 1127048364 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 15:55052201-55052223 |
| Sequence | AAATCTAGAGAGCTTGTCAC TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1127048364_1127048366 | -10 | Left | 1127048364 | 15:55052201-55052223 | CCAGTGACAAGCTCTCTAGATTT | No data | ||
| Right | 1127048366 | 15:55052214-55052236 | CTCTAGATTTCTTCTTACATGGG | No data | ||||
| 1127048364_1127048367 | 16 | Left | 1127048364 | 15:55052201-55052223 | CCAGTGACAAGCTCTCTAGATTT | No data | ||
| Right | 1127048367 | 15:55052240-55052262 | AATGACCTCCTCTTTGTTTAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1127048364 | Original CRISPR | AAATCTAGAGAGCTTGTCAC TGG (reversed) | Intergenic | ||