ID: 1127048364

View in Genome Browser
Species Human (GRCh38)
Location 15:55052201-55052223
Sequence AAATCTAGAGAGCTTGTCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127048364_1127048366 -10 Left 1127048364 15:55052201-55052223 CCAGTGACAAGCTCTCTAGATTT No data
Right 1127048366 15:55052214-55052236 CTCTAGATTTCTTCTTACATGGG No data
1127048364_1127048367 16 Left 1127048364 15:55052201-55052223 CCAGTGACAAGCTCTCTAGATTT No data
Right 1127048367 15:55052240-55052262 AATGACCTCCTCTTTGTTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127048364 Original CRISPR AAATCTAGAGAGCTTGTCAC TGG (reversed) Intergenic