ID: 1127049038

View in Genome Browser
Species Human (GRCh38)
Location 15:55060983-55061005
Sequence TGCCATCTGGTGATTATTAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127049031_1127049038 8 Left 1127049031 15:55060952-55060974 CCTCCTTCCTGCACCACAGGGCA No data
Right 1127049038 15:55060983-55061005 TGCCATCTGGTGATTATTAGGGG No data
1127049033_1127049038 1 Left 1127049033 15:55060959-55060981 CCTGCACCACAGGGCATAGCTTT No data
Right 1127049038 15:55060983-55061005 TGCCATCTGGTGATTATTAGGGG No data
1127049034_1127049038 -5 Left 1127049034 15:55060965-55060987 CCACAGGGCATAGCTTTATGCCA No data
Right 1127049038 15:55060983-55061005 TGCCATCTGGTGATTATTAGGGG No data
1127049028_1127049038 15 Left 1127049028 15:55060945-55060967 CCAGTTTCCTCCTTCCTGCACCA No data
Right 1127049038 15:55060983-55061005 TGCCATCTGGTGATTATTAGGGG No data
1127049027_1127049038 16 Left 1127049027 15:55060944-55060966 CCCAGTTTCCTCCTTCCTGCACC No data
Right 1127049038 15:55060983-55061005 TGCCATCTGGTGATTATTAGGGG No data
1127049032_1127049038 5 Left 1127049032 15:55060955-55060977 CCTTCCTGCACCACAGGGCATAG No data
Right 1127049038 15:55060983-55061005 TGCCATCTGGTGATTATTAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127049038 Original CRISPR TGCCATCTGGTGATTATTAG GGG Intergenic
No off target data available for this crispr