ID: 1127051115

View in Genome Browser
Species Human (GRCh38)
Location 15:55085129-55085151
Sequence CTGTAAAACCAAAAGCAAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127051115_1127051120 22 Left 1127051115 15:55085129-55085151 CCAACTTGCTTTTGGTTTTACAG No data
Right 1127051120 15:55085174-55085196 CCTTGTCTCAGATGAGACTTTGG 0: 1546
1: 2112
2: 1626
3: 919
4: 622
1127051115_1127051118 -7 Left 1127051115 15:55085129-55085151 CCAACTTGCTTTTGGTTTTACAG No data
Right 1127051118 15:55085145-55085167 TTTACAGGCTCATAGGCAGAAGG 0: 747
1: 1140
2: 1695
3: 1474
4: 1122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127051115 Original CRISPR CTGTAAAACCAAAAGCAAGT TGG (reversed) Intergenic
No off target data available for this crispr