ID: 1127054292

View in Genome Browser
Species Human (GRCh38)
Location 15:55115927-55115949
Sequence GTGCATGCACAGTGGCCTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127054289_1127054292 14 Left 1127054289 15:55115890-55115912 CCACAGAGTGATGAAGGAAACTG No data
Right 1127054292 15:55115927-55115949 GTGCATGCACAGTGGCCTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127054292 Original CRISPR GTGCATGCACAGTGGCCTCT TGG Intergenic
No off target data available for this crispr