ID: 1127055513

View in Genome Browser
Species Human (GRCh38)
Location 15:55127071-55127093
Sequence GACATCTTGGCAAAGTCTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127055502_1127055513 27 Left 1127055502 15:55127021-55127043 CCTTATTATTAATACTGGTTTGC No data
Right 1127055513 15:55127071-55127093 GACATCTTGGCAAAGTCTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127055513 Original CRISPR GACATCTTGGCAAAGTCTGA AGG Intergenic
No off target data available for this crispr