ID: 1127056441

View in Genome Browser
Species Human (GRCh38)
Location 15:55136718-55136740
Sequence CAGGTACACCAATTAAAGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127056441_1127056444 7 Left 1127056441 15:55136718-55136740 CCTACCTTTAATTGGTGTACCTG No data
Right 1127056444 15:55136748-55136770 CAGAGAGAATGAAACCAAGCTGG No data
1127056441_1127056446 22 Left 1127056441 15:55136718-55136740 CCTACCTTTAATTGGTGTACCTG No data
Right 1127056446 15:55136763-55136785 CAAGCTGGAAAACATACTTCAGG 0: 18
1: 259
2: 961
3: 2451
4: 6802

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127056441 Original CRISPR CAGGTACACCAATTAAAGGT AGG (reversed) Intergenic
No off target data available for this crispr