ID: 1127057862

View in Genome Browser
Species Human (GRCh38)
Location 15:55150856-55150878
Sequence AAATTGCCACAAATATATGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127057862_1127057865 8 Left 1127057862 15:55150856-55150878 CCACCATATATTTGTGGCAATTT No data
Right 1127057865 15:55150887-55150909 AACAACAGAAAATGAATTCAGGG No data
1127057862_1127057864 7 Left 1127057862 15:55150856-55150878 CCACCATATATTTGTGGCAATTT No data
Right 1127057864 15:55150886-55150908 CAACAACAGAAAATGAATTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127057862 Original CRISPR AAATTGCCACAAATATATGG TGG (reversed) Intergenic
No off target data available for this crispr