ID: 1127061142

View in Genome Browser
Species Human (GRCh38)
Location 15:55186817-55186839
Sequence CTGGAAATACATATTAAACT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 329
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 301}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127061142 Original CRISPR CTGGAAATACATATTAAACT AGG Intronic
900434032 1:2618773-2618795 ATGTAAATACATATTCAAATTGG - Intronic
901707057 1:11081919-11081941 CTGGAAATACAAAATTAGCTGGG + Intronic
903314318 1:22489363-22489385 CTGAAAATACATTTTTCACTTGG - Intronic
906233972 1:44192092-44192114 TTACAAATACATATAAAACTCGG + Intergenic
911387981 1:97201591-97201613 CTGGAGATACATAGTAAATAGGG + Intronic
911501110 1:98685625-98685647 CTTAAAATACAGATTATACTAGG - Intronic
912552982 1:110496480-110496502 CTGGAATTACATTTTGAGCTAGG + Intergenic
915444768 1:155968327-155968349 CTGTAAATCCCTATGAAACTTGG - Intronic
917688349 1:177441638-177441660 AATGAAATACATAGTAAACTGGG + Intergenic
918656638 1:187034993-187035015 CTGGAAATATAATTGAAACTTGG - Intergenic
918974205 1:191460708-191460730 CTCCAAATATATATTACACTGGG + Intergenic
919029492 1:192222411-192222433 ATGAAAATACATAGTAATCTTGG - Intergenic
919261665 1:195203347-195203369 CTGCAAATAAATCTTAAACGGGG - Intergenic
919324997 1:196096366-196096388 CTGGAAATACATAGAAAAATAGG - Intergenic
920867223 1:209763149-209763171 CTGGAATTCCATGATAAACTTGG + Intronic
922299344 1:224282902-224282924 CTAGAGATACATATAAAATTAGG - Intronic
923187674 1:231589730-231589752 CTAAAAATACAAATTTAACTGGG + Intronic
1064435659 10:15308973-15308995 ATGGAAATACTGATTAAAATAGG - Intronic
1064734211 10:18364105-18364127 CTGAAAATACAAAATCAACTGGG - Intronic
1065572059 10:27081193-27081215 CTAGAAAGGCATATTAAAATAGG - Intronic
1066104734 10:32146500-32146522 CCTGAAATTCATATTTAACTGGG - Intergenic
1067758321 10:49023952-49023974 CTGGATATAAATGTAAAACTCGG - Intronic
1069236313 10:66079456-66079478 AAGAAAATACATATAAAACTAGG - Intronic
1069391942 10:67945329-67945351 CTGGATATACATACTATTCTAGG - Intronic
1071181492 10:82989435-82989457 AGGGAAAGAAATATTAAACTAGG - Intergenic
1071789390 10:88938347-88938369 CTGGGAAGACATAATAATCTAGG + Intronic
1072135826 10:92544669-92544691 CAGGAAACAAAAATTAAACTAGG + Intronic
1073928187 10:108541996-108542018 ATGGAAACACATATTAAACCTGG + Intergenic
1075244306 10:120807006-120807028 CTGGTAACTCGTATTAAACTTGG + Intergenic
1075301255 10:121326558-121326580 CTGGAAAAAGAAATTAAAGTTGG + Intergenic
1076257381 10:129038741-129038763 CTGGAAATAGATGTTTATCTTGG + Intergenic
1076303507 10:129446692-129446714 TTGGAAATTCATATTTAACTGGG + Intergenic
1078566304 11:12417690-12417712 CTGTAAATACAAACTTAACTTGG - Intronic
1079274907 11:19026298-19026320 CTGGAAAGACAGAGTAAACATGG - Intergenic
1079728555 11:23909264-23909286 CTTAAAATAAATAATAAACTTGG + Intergenic
1080508282 11:32940506-32940528 TTGGTCATACAAATTAAACTGGG + Intronic
1083415702 11:62524193-62524215 CAGGAAAGGCATTTTAAACTTGG + Exonic
1084191107 11:67499143-67499165 CTGGAAATACAAACTGACCTGGG - Intronic
1084455686 11:69266923-69266945 CTGTAAATACAGATGAAGCTTGG - Intergenic
1085061670 11:73453056-73453078 CTTCAAATACATTTTAACCTTGG + Intronic
1086859172 11:91904697-91904719 ATGGAAATACATATGAAACAAGG - Intergenic
1087530948 11:99381294-99381316 CAGGAAATATCAATTAAACTAGG + Intronic
1087822668 11:102729685-102729707 CTGAAAATACAAAATAAGCTGGG + Intergenic
1088167927 11:106960334-106960356 CTGGTAATATATCTTACACTTGG - Intronic
1088769747 11:113021991-113022013 CTGGAAAAATATTTTAAAATAGG + Intronic
1089885511 11:121818856-121818878 CTGTAAATACACAAAAAACTAGG - Intergenic
1091158150 11:133393265-133393287 ATGGAAATACACATAAAACAAGG + Intronic
1093915114 12:24793304-24793326 CTAGAAATACATTTTAATCCAGG + Intergenic
1094003861 12:25726544-25726566 CTTGAAATTCAGATTTAACTGGG + Intergenic
1094101234 12:26766123-26766145 GTGGACATACATTTTCAACTAGG + Intronic
1094166066 12:27445426-27445448 CTTGAAATTCAAATTTAACTGGG + Intergenic
1094341638 12:29418604-29418626 CTGGAAAAACGTATTGAATTTGG - Intronic
1096335439 12:50751814-50751836 CTGAAAATACAAATTCAGCTGGG + Intergenic
1098145793 12:67496686-67496708 CTGCAAATAAATATGACACTGGG - Intergenic
1098888608 12:75984871-75984893 CCTGAAATGCATATTAAACTGGG + Intergenic
1099552301 12:84062775-84062797 TTGGAAAAACAGATTAAATTTGG - Intergenic
1100032702 12:90212501-90212523 CTGGAAAGAAAGATGAAACTTGG - Intergenic
1100649313 12:96567418-96567440 CTGGAAATTCAAATTTAACCAGG - Intronic
1102408449 12:112695147-112695169 CTTGAAATTCAAATTTAACTGGG + Intronic
1105640515 13:22259047-22259069 CTGGAAAAAAATAATAAACAAGG - Intergenic
1106969248 13:35116902-35116924 CAGAAAATACATATTATAGTGGG - Intronic
1111251512 13:85607747-85607769 ATGGAAATTCATGTTAAATTAGG + Intergenic
1112681685 13:101774230-101774252 CTGGAACTACATACAAAAATGGG - Intronic
1112714362 13:102166769-102166791 ATAGAAACACATATTAAACAAGG + Intronic
1112757193 13:102649778-102649800 ATGTAAATACAAATCAAACTTGG + Intronic
1114879115 14:26761784-26761806 CTGCAAATACAGACTAAGCTTGG - Intergenic
1115179413 14:30605055-30605077 CTGAAAATACAAAATAAGCTGGG - Intronic
1115374622 14:32660763-32660785 ATGGAAATGCTAATTAAACTGGG + Intronic
1116017191 14:39421346-39421368 ATGGAAAGACATATTTACCTTGG + Intronic
1116327633 14:43551825-43551847 ATGGAAATTGATTTTAAACTGGG + Intergenic
1116992479 14:51291014-51291036 CTGCAAATACAGATTAACATTGG - Intergenic
1117405064 14:55393906-55393928 ATGGAAAAAAATAATAAACTAGG - Intronic
1118048778 14:62003684-62003706 TTGGACATTCTTATTAAACTGGG + Intronic
1118098251 14:62564316-62564338 CTGGAAATAAATTTTACATTAGG - Intergenic
1118286802 14:64482046-64482068 AAGGAAATACATATTAATCGTGG - Exonic
1119455601 14:74752768-74752790 CTGAAAATACACATTTAGCTAGG - Intergenic
1120577059 14:86195619-86195641 CTAAAAATACAAAATAAACTGGG - Intergenic
1122447254 14:101779086-101779108 CTGAAAAGACATACAAAACTAGG + Intronic
1123693678 15:22861144-22861166 CTGGAAAAACAAATTATACAGGG - Intronic
1124265424 15:28228912-28228934 CAGGAAATAAATATTAATATAGG + Intronic
1124390281 15:29249470-29249492 CTGGAAGGACATAATCAACTGGG + Intronic
1124869717 15:33528513-33528535 ATGGAAACACCTATTAAAATAGG - Intronic
1125135183 15:36333047-36333069 CTGTAAATATAGATGAAACTTGG - Intergenic
1125375133 15:39020770-39020792 CTCAAAATAAATATGAAACTAGG - Intergenic
1125828822 15:42697112-42697134 CTGGAAATATACAACAAACTGGG - Intronic
1125836349 15:42754845-42754867 CTAAAAATACAAAATAAACTGGG + Intronic
1127061142 15:55186817-55186839 CTGGAAATACATATTAAACTAGG + Intronic
1127063550 15:55213562-55213584 CTGTAAATACAGATGAAACTTGG - Intronic
1131949035 15:97660794-97660816 CATGAAATTCATATTTAACTTGG + Intergenic
1132935745 16:2479991-2480013 CTGAAAATACAAAATTAACTGGG - Intronic
1134379043 16:13707402-13707424 CTGTAAATACAGATGAAGCTTGG - Intergenic
1135280312 16:21148667-21148689 CTGTAGAAACAAATTAAACTAGG + Intronic
1136154319 16:28372723-28372745 ATAGAAATACATATTTAATTTGG - Intergenic
1136208771 16:28742539-28742561 ATAGAAATACATATTTAATTTGG + Intergenic
1136703600 16:32166247-32166269 CAGGAAATAAATATTAATATAGG + Intergenic
1138787151 16:59860883-59860905 ATGGAAATACTTATTTAACATGG + Intergenic
1139158214 16:64470415-64470437 CTGGAAATACAGATCTACCTTGG + Intergenic
1141273711 16:82565319-82565341 CTGAAAATACAAAATTAACTAGG + Intergenic
1141314186 16:82944937-82944959 GGGGAAATACAAATTAAAGTAGG + Intronic
1141350178 16:83287401-83287423 CTGTAAATACAGATGAAGCTTGG - Intronic
1203066457 16_KI270728v1_random:1023477-1023499 CAGGAAATAAATATTAATATAGG - Intergenic
1143997805 17:11023126-11023148 CTGAAAATACAAAATTAACTGGG + Intergenic
1144147675 17:12414045-12414067 CAGGAAGTACATCTTAAACCCGG + Intergenic
1146221505 17:31026448-31026470 CTGAAAATACAAAATTAACTGGG + Intergenic
1147029513 17:37620656-37620678 TTGGAAATACATATTCAAAATGG - Intronic
1150182940 17:63145838-63145860 CTTGAAAAAAATAATAAACTTGG - Intronic
1150455865 17:65305995-65306017 CTGTAAATACAGATGAAGCTTGG + Intergenic
1155367005 18:25058719-25058741 CTGTAAATACAGATGAAGCTTGG + Intergenic
1155825176 18:30432731-30432753 CAGGTAAAACATATTATACTAGG - Intergenic
1158390003 18:57037224-57037246 CTGGAAACACAGAGGAAACTGGG - Intergenic
1158764079 18:60426716-60426738 TTGGAAATACGTATAAAAATGGG + Intergenic
1160032881 18:75278140-75278162 CTGAAAAGACAGAGTAAACTGGG - Intronic
1162599904 19:11660811-11660833 CTGGAAAAAAATTTTAAGCTGGG + Intergenic
1163044965 19:14634364-14634386 TTGGAGATACATATTTAAATTGG + Intronic
1164639956 19:29817427-29817449 CTGGAAAATCATGTTAAACAAGG + Exonic
1164943842 19:32273349-32273371 CTGGAGATACAGATTAACGTTGG - Intergenic
1165141361 19:33702133-33702155 CTAAAAATACAAAATAAACTGGG - Intronic
1166511251 19:43410398-43410420 CTGGGAATAGATATTAGACAGGG + Intronic
926130238 2:10298399-10298421 CTGTAATTACAAATGAAACTGGG + Intergenic
926288001 2:11505914-11505936 CTGTAAATAAATATTAAATCAGG + Intergenic
927020474 2:19011440-19011462 CTGGAAATAAATTTTAAAGGAGG + Intergenic
927085329 2:19669529-19669551 CTGGGAATACAAATTCAAATAGG + Intergenic
927808926 2:26171487-26171509 CTGGAATTACATATGTAGCTGGG - Intergenic
929735322 2:44541965-44541987 CTAAAAATACAAATTAAACCGGG + Intronic
929908179 2:46064716-46064738 CTGGTAACATATAATAAACTAGG + Intronic
930401259 2:50892441-50892463 ATGGAAAAACATATTATACTGGG - Intronic
930545729 2:52765398-52765420 CAGGACATATATATAAAACTGGG + Intergenic
933125084 2:78594640-78594662 CATGAAATACATATTAATATGGG + Intergenic
933278548 2:80307274-80307296 CTTTAAATACATAATAAATTGGG - Intronic
935227992 2:101070904-101070926 GTCAATATACATATTAAACTTGG + Intronic
935470595 2:103455252-103455274 CTAGAGATGCATTTTAAACTTGG - Intergenic
937745975 2:125415793-125415815 CTAGAAATAAATATTTTACTTGG + Intergenic
938222227 2:129580282-129580304 CTGGTAATTCATATGAAACCTGG - Intergenic
938440286 2:131324285-131324307 CTGAAAATACTTAAGAAACTTGG - Intronic
938599771 2:132825273-132825295 CTGGAAGTTCATATTAAATGTGG - Intronic
939383670 2:141467965-141467987 CTGGAAAGACCCATCAAACTGGG - Intronic
940361492 2:152800683-152800705 TTGAAAATACTTATTATACTAGG - Intergenic
941449153 2:165638298-165638320 CTAAAAATACAAAATAAACTGGG + Intronic
943639755 2:190344611-190344633 CTGGAAAAAAATATTTAACCTGG + Intronic
943739277 2:191393519-191393541 TTGGAAATACATTTTTAATTTGG + Intronic
943829644 2:192443959-192443981 CAGGAAAAACAAATCAAACTTGG + Intergenic
945657269 2:212640380-212640402 AGGCAAATACATATTAAAGTTGG - Intergenic
945764935 2:213964024-213964046 ATGGAAGTACATATAAAACAAGG + Intronic
947340436 2:229132743-229132765 TTGGAATTACATATTGAATTGGG - Intronic
947782201 2:232778235-232778257 CTGAGAATACATATTATAGTAGG + Intronic
1170688673 20:18592313-18592335 CTTGAAATACAGATTTAGCTGGG + Intronic
1171963382 20:31511882-31511904 CTGAAAATACAAAATTAACTGGG + Intergenic
1174089033 20:48031906-48031928 CTGGAGCTTCATATTAAACAGGG + Intergenic
1174859599 20:54078310-54078332 CTTGAAATTCAAATTTAACTGGG + Intergenic
1177893898 21:26839108-26839130 TTGAAAACACATATTGAACTAGG - Intronic
1178330179 21:31683310-31683332 TTGGAAAAACATAGTAAGCTAGG - Intronic
1178475062 21:32930892-32930914 CTGTAAATACAGATGAAGCTTGG + Intergenic
1179559052 21:42201201-42201223 CTGCAAATACAGATTAACATTGG - Intronic
1180555979 22:16575075-16575097 CTCGAAATCCATTTTAAACTTGG - Intergenic
1181829582 22:25549258-25549280 CTGTAAATACAGATGAAGCTTGG - Intergenic
1182912364 22:33995739-33995761 GTGGAAAAACATATCAAACTGGG + Intergenic
949388908 3:3537276-3537298 GTATAAATACATATTAAACAGGG + Intergenic
950059989 3:10062844-10062866 CTAAAAATACAAATTTAACTGGG - Intronic
950317885 3:12021414-12021436 ATAGAAATACATGTTAAAATGGG - Intronic
952271037 3:31831556-31831578 CTGGAAATAATTATTAAAATGGG + Intronic
954172317 3:48814616-48814638 CTGGAAATACAAATGGAACAAGG - Intronic
955346981 3:58168515-58168537 CTGGCAATCCATTTTAACCTTGG - Exonic
955665501 3:61345524-61345546 CTGAAAATACAAAATTAACTGGG - Intergenic
955727805 3:61951599-61951621 CTGGAAATACACAGGAAATTAGG - Intronic
955816834 3:62852633-62852655 CAGGAAATTCAGAGTAAACTGGG - Intronic
955909243 3:63843277-63843299 CTGGAAATACAAAATTAGCTGGG - Intronic
956050030 3:65237834-65237856 CTGAAAATACAAAATTAACTGGG - Intergenic
956841505 3:73144261-73144283 CTGGAAAGACTTCTCAAACTGGG - Intergenic
957330928 3:78762412-78762434 CTGGAAATATAAATGAAATTAGG - Intronic
957618878 3:82569353-82569375 CTGTAAATAGAAATCAAACTGGG - Intergenic
957636697 3:82795109-82795131 TTTGAAATATATTTTAAACTTGG - Intergenic
957669096 3:83277583-83277605 GTGGAAATCCCTATTAATCTAGG - Intergenic
958889553 3:99768440-99768462 CTAGAAATACATATTACATTTGG - Intronic
958937826 3:100276463-100276485 TTGGAAATGCATATTAAATTTGG + Intronic
959409856 3:106007463-106007485 TTGGAAATAAATTTTATACTTGG - Intergenic
960453399 3:117839268-117839290 CTGGAAATACATAAAAATGTGGG + Intergenic
960914288 3:122680957-122680979 CTGGAAGTACATCTGCAACTTGG - Exonic
961146622 3:124599158-124599180 TCGGAAATACTTTTTAAACTTGG - Intronic
961801693 3:129455470-129455492 CATTAAATACTTATTAAACTTGG - Intronic
962100944 3:132341989-132342011 TTGGCTATACATATAAAACTTGG - Intronic
962501309 3:135996120-135996142 ATGGAAATACATCTTATAGTTGG - Intronic
963155800 3:142095149-142095171 CTGAAAATACATAATTAGCTGGG - Intronic
963700939 3:148626160-148626182 CAGGAAATGCTTATGAAACTTGG - Intergenic
964220755 3:154341799-154341821 CTGTAGCTACATATTATACTTGG - Intronic
965633126 3:170753806-170753828 CTTGAAATACATTTTAAAATGGG + Intronic
966368660 3:179221596-179221618 CTCGAAATCCATTTTAAACTTGG - Intronic
967460693 3:189742653-189742675 CTTGAAATATATATGAATCTTGG - Intronic
967543657 3:190698251-190698273 TTGGAAATATATTTAAAACTAGG - Intergenic
967637726 3:191823696-191823718 CTGTAAATTCATATGATACTGGG - Intergenic
968329551 3:197854841-197854863 CTGAAAATACATCATAAAATTGG - Intronic
968895594 4:3400969-3400991 CAAGAAAAAAATATTAAACTTGG + Intronic
970063828 4:12068245-12068267 ATGGAAATACATTTTAGGCTGGG + Intergenic
971534438 4:27730932-27730954 CTGGAATTACATAATTAAATAGG - Intergenic
971673775 4:29597271-29597293 TTTGAAATACATAATAAATTGGG + Intergenic
971762575 4:30786598-30786620 CTGCAAATACATCTTAAAGAAGG + Intronic
971837391 4:31786161-31786183 CTGTAAATACAGATAAAGCTTGG - Intergenic
972708718 4:41571956-41571978 CTGGAAATATATTTGAGACTGGG + Intronic
973992222 4:56421042-56421064 CTGTAAATACAGATGAAGCTTGG - Intronic
974805530 4:66875219-66875241 ATAGAAATACATATAAAACAAGG - Intergenic
975004536 4:69269405-69269427 CTGGAAAGAGATCGTAAACTTGG + Intergenic
975465343 4:74703134-74703156 CTGGAATTACATGTTAAACATGG - Intergenic
976119271 4:81762031-81762053 CAGGAAACCCAAATTAAACTAGG - Intronic
976631239 4:87238767-87238789 CTGGAAATACATATGATAGAAGG + Intronic
976856217 4:89608552-89608574 GTGTAAATAGATATTAAAATGGG + Intergenic
977428815 4:96904997-96905019 TTGAAACTACAGATTAAACTGGG - Intergenic
977899440 4:102402502-102402524 CTGGAAATGCAAATAATACTTGG - Intronic
978316127 4:107439479-107439501 CTGCAAATACAGATTAACATTGG - Intergenic
978347276 4:107784955-107784977 ATGGAAATACAGAGAAAACTTGG - Intergenic
978457980 4:108916330-108916352 CTTGAAATATAATTTAAACTTGG + Intronic
979202725 4:117997767-117997789 TGGGAAAAACATATTAAACTGGG + Intergenic
979623458 4:122821330-122821352 CTGCAAATACAGATTAACATTGG - Intergenic
979987219 4:127330099-127330121 CTGGAAATAGATATCAAGTTTGG - Intergenic
980687969 4:136254895-136254917 CTAAAAATACTTAATAAACTAGG + Intergenic
980890522 4:138810026-138810048 CTGGAAATACATAATGAAGTAGG + Intergenic
981182651 4:141763963-141763985 CTGTAAATACACATGAAGCTGGG + Intergenic
981891082 4:149738246-149738268 CTGGAAATTCCTCTGAAACTTGG + Intergenic
982039959 4:151387556-151387578 CTGCAAATACAGATTAACATTGG - Intergenic
982404103 4:155001533-155001555 ATGGAAACACATAATAAATTAGG + Intergenic
982972359 4:162005246-162005268 CTTGAAATACAAATTTCACTTGG + Intronic
983366830 4:166801831-166801853 CAGGAATTACATATTAATCTAGG + Intronic
983574874 4:169250037-169250059 GTGGAAACACCTATTAATCTTGG - Intronic
983928278 4:173426156-173426178 CTTGAAATACAAATTTAATTGGG + Intergenic
984152215 4:176147846-176147868 ATGGAAATGAATATTTAACTAGG - Intronic
984409917 4:179384255-179384277 CTGGCAATTCATATTTTACTTGG + Intergenic
984409977 4:179385366-179385388 CTGGCAATTCATATTTTACTTGG + Intergenic
986769714 5:10961624-10961646 GTAGAAATATAGATTAAACTAGG + Intergenic
987937771 5:24489870-24489892 GTGGAAATACAGATTCCACTGGG + Intronic
988089961 5:26525605-26525627 TTGGAAATACATCTAAAAGTGGG - Intergenic
988158140 5:27481225-27481247 ATCGAACAACATATTAAACTTGG - Intergenic
988449550 5:31327137-31327159 CTGGAAATAGATATCCCACTGGG + Exonic
990684326 5:58284525-58284547 CTGGAAAAAGATGATAAACTAGG - Intergenic
991160505 5:63493848-63493870 CTTGCAATAAATATTAAAATAGG - Intergenic
992294475 5:75313899-75313921 CTGAAAATACAAAATAAGCTGGG - Intergenic
993046980 5:82878643-82878665 CTGTAAATATATATTCACCTAGG - Intergenic
993317620 5:86430933-86430955 ATGGAAATACCTGTTAAAGTAGG + Intergenic
994671479 5:102766515-102766537 CTGTAAATACAGATGAAGCTTGG + Intronic
995404038 5:111774041-111774063 CTGGGAATACATATTGAATGGGG - Intronic
995973392 5:118001206-118001228 CTTGAAATAAATAATATACTAGG + Intergenic
996772016 5:127095909-127095931 CTGAAAATAAATACAAAACTAGG - Intergenic
997654482 5:135545168-135545190 CTGGATTAACATTTTAAACTCGG - Intergenic
998770774 5:145542315-145542337 CTGGAAATACAATTGTAACTAGG - Intronic
999545197 5:152621431-152621453 CTGGAAAGACATATAGAACTGGG + Intergenic
1000486553 5:161851710-161851732 CTGGAAAGACATATGAATTTAGG + Intronic
1000614534 5:163412763-163412785 ATGTAAATTCATATGAAACTAGG - Intergenic
1002291975 5:178206168-178206190 ATGAAAATACAGATTAAGCTGGG + Intronic
1004156839 6:13176851-13176873 CTAGAGATACATTTTAAACATGG + Intronic
1004972690 6:20929319-20929341 CTGGTAATAAAGATTAACCTTGG + Intronic
1005275738 6:24215630-24215652 AAGGCAATACATATTAAAATTGG + Intronic
1005917689 6:30367960-30367982 CTAGAACTACATATTTAAATTGG - Intergenic
1006229295 6:32568793-32568815 CTGGAAATCCAAATTTAAGTGGG - Intronic
1006230865 6:32584983-32585005 TTGGAAATCCAAATTTAACTGGG - Intronic
1007336375 6:41157931-41157953 CTGGAAATCCAAATTTCACTTGG - Intergenic
1008892098 6:56506731-56506753 CTGGATATAGTTATTAACCTAGG - Exonic
1010282373 6:74036533-74036555 CAGGAAATAAATAATAAATTTGG - Intergenic
1011367203 6:86596015-86596037 GTGAAAATACATATTAAAAAAGG - Intergenic
1012949264 6:105500797-105500819 CAGGCATTACTTATTAAACTGGG - Intergenic
1015124913 6:129743089-129743111 CTGAATATACATTTTAAAATGGG + Intergenic
1015897603 6:138032539-138032561 CTAGAAATGCATAGTGAACTAGG + Intergenic
1016246039 6:141982077-141982099 GTGGAAATATATATTAAAAAAGG - Intergenic
1017268932 6:152483460-152483482 CTGAAAATACATCTTAAACATGG + Intronic
1018312103 6:162521019-162521041 CTGGAAAAAAATATTAATCATGG - Intronic
1021161246 7:17275568-17275590 CTTCAAATACATTTTAAAGTAGG - Intergenic
1022202292 7:28128226-28128248 CTAGAAATGCATATTCGACTGGG + Intronic
1022870626 7:34474334-34474356 TTGTAACTACATCTTAAACTAGG - Intergenic
1022877297 7:34547734-34547756 TTGGAAATACATGTTAAAATGGG + Intergenic
1024742834 7:52373235-52373257 TTGGAAATACTTTTTAAGCTTGG + Intergenic
1025173837 7:56786140-56786162 CTTAAATTCCATATTAAACTAGG + Intergenic
1025698264 7:63792027-63792049 CTTAAATTCCATATTAAACTAGG - Intergenic
1025829995 7:65040277-65040299 CTTAAATTCCATATTAAACTAGG - Intergenic
1026316025 7:69228396-69228418 CTGCAAATACAGATGAAGCTTGG + Intergenic
1026404092 7:70046917-70046939 ATGGAATGACTTATTAAACTTGG - Intronic
1027413271 7:77945175-77945197 CTGAAAATACAAAATTAACTGGG + Intronic
1028605944 7:92655998-92656020 CTGGAAATACATGATAGAATTGG - Intronic
1029047641 7:97646575-97646597 CTGTAAATACAGATGATACTTGG + Intergenic
1030484866 7:110152560-110152582 CTGGATCTACAAACTAAACTAGG + Intergenic
1031192620 7:118573938-118573960 ATTGAAATACATTTTAAATTAGG + Intergenic
1031454806 7:121965850-121965872 ATTGATATACACATTAAACTTGG - Intronic
1031501176 7:122518747-122518769 CTGGGAACACACATTTAACTGGG + Intronic
1033164205 7:139025285-139025307 CTAAAAATACATAATTAACTGGG + Intergenic
1035830028 8:2685802-2685824 CTGGAAATACGTAATAAATTTGG - Intergenic
1035867941 8:3104866-3104888 CTGAAAATACAAAATTAACTGGG - Intronic
1037936671 8:22919589-22919611 CTGGAAATAACTATTTTACTGGG - Intronic
1038827590 8:31021758-31021780 CTGGAAAATCATATGAAAATGGG + Intronic
1039462577 8:37758011-37758033 GTTGAAATTCATATTTAACTAGG - Exonic
1040454364 8:47581257-47581279 CTGAAAATAAAAAATAAACTAGG - Intronic
1041191536 8:55360457-55360479 ATGAAAATACATGTCAAACTAGG - Intronic
1041861648 8:62520512-62520534 CCTGAAACACATCTTAAACTGGG + Intronic
1042202856 8:66298672-66298694 CTGGAAACACACATTTTACTTGG + Intergenic
1043070219 8:75627410-75627432 CTGGAAACACTTGTTGAACTTGG + Intergenic
1043160919 8:76846064-76846086 CTGGAAATGCCTATTAAATAAGG - Intronic
1044086204 8:87945125-87945147 CTGGAAACACAGAAGAAACTTGG + Intergenic
1044554443 8:93547268-93547290 CTCGAACTATATATTAAAATAGG + Intergenic
1046639421 8:116710364-116710386 CTGAAAATACAGATCAAGCTGGG - Intronic
1047454039 8:124992702-124992724 GTGGCAATACATATTGAACTAGG - Intergenic
1048908910 8:139115564-139115586 CTGGAAATACTTCCTACACTGGG - Intergenic
1050012418 9:1198709-1198731 CTTAAGATACATGTTAAACTAGG + Intergenic
1050078109 9:1886323-1886345 CTGGAAATAATTGTTAAAGTTGG - Intergenic
1051267068 9:15319302-15319324 CTGGAAACACATTTAAAAGTTGG + Intergenic
1052570782 9:30219451-30219473 TTTGAAATACAAATTTAACTGGG - Intergenic
1052769304 9:32672835-32672857 CTGGAAATCTTTATTACACTTGG - Intergenic
1052972629 9:34386292-34386314 CGGGAATTACATTTTAAAGTAGG - Intronic
1053099513 9:35359409-35359431 CTGGGAATGCTTATGAAACTCGG - Intronic
1055498185 9:76876569-76876591 CTAGACATACCTATTACACTTGG + Intronic
1056902724 9:90614851-90614873 ATAAAAATAAATATTAAACTAGG - Intronic
1058035183 9:100244466-100244488 CTGTATATATATATTAAATTTGG - Intronic
1058261309 9:102836097-102836119 CTGTATATACAAATTATACTAGG + Intergenic
1058567472 9:106301973-106301995 ATGGAAATACTGATTAAAGTGGG - Intergenic
1059443185 9:114322502-114322524 CTGGAAATAGACATTCAACTTGG + Intergenic
1059444378 9:114329273-114329295 CTGGAAATAGACATTCAACTTGG + Intergenic
1059870871 9:118574432-118574454 CTGGAAACACCTATTAAACTAGG + Intergenic
1060564694 9:124579847-124579869 CTGAAAATACATAATTAGCTGGG + Intronic
1185740599 X:2529020-2529042 CTGTAAATGCATTTAAAACTTGG - Intergenic
1185801958 X:3019358-3019380 CAGGAAATACATAGAAAATTGGG + Intronic
1186204826 X:7190389-7190411 CTGTAAATACAGATGAAGCTTGG + Intergenic
1186533722 X:10325627-10325649 CGGGAAGTACAAATTAATCTAGG + Intergenic
1187167216 X:16815334-16815356 CTAAAAATACAAATTTAACTGGG - Intronic
1187352472 X:18533576-18533598 CAGTAAATACATATTTAAGTTGG + Intronic
1187596821 X:20782553-20782575 ATGGAAATACATAGTGAAGTTGG + Intergenic
1188085995 X:25902004-25902026 TTGGAAATATAAATTAAAATTGG - Intergenic
1189724274 X:43952850-43952872 CTGGAAATACATGTGAAACCTGG - Intronic
1191800929 X:65078482-65078504 CTGGAAATACTTACTTCACTTGG - Intergenic
1191912076 X:66162209-66162231 CTTGAAAAACATTTTAAAGTTGG - Intergenic
1193279753 X:79632443-79632465 AAATAAATACATATTAAACTGGG - Intergenic
1193454782 X:81717450-81717472 CTCAAAGAACATATTAAACTCGG + Intergenic
1194846632 X:98817431-98817453 ATGGGGATACATATTAAAATTGG - Intergenic
1195407708 X:104534798-104534820 CTGGTAGTATATATTAAATTGGG + Intergenic
1196186090 X:112746596-112746618 CTGGACATTCACATGAAACTTGG + Intergenic
1196536298 X:116848954-116848976 CTGGAATTACATTTTAAAAATGG + Intergenic
1198099432 X:133412013-133412035 CTGGAATAAAACATTAAACTTGG + Intronic