ID: 1127063550

View in Genome Browser
Species Human (GRCh38)
Location 15:55213562-55213584
Sequence CTGTAAATACAGATGAAACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 316
Summary {0: 1, 1: 12, 2: 18, 3: 42, 4: 243}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127063550 Original CRISPR CTGTAAATACAGATGAAACT TGG (reversed) Intronic
900587284 1:3439467-3439489 CTGTAAACACAGAGGAAGCTGGG + Intergenic
900766626 1:4510166-4510188 CTGAAAATACAGAGGAATTTAGG + Intergenic
901585014 1:10282903-10282925 CTGTTAATAAAGATGAAGTTTGG + Intronic
903102246 1:21040825-21040847 CTGTAAAAACAGCTGAGTCTTGG + Intronic
903510831 1:23873873-23873895 CTGGAAATACAGAGGAGGCTGGG - Exonic
905052692 1:35065556-35065578 CTTTAAATACAGTTGACTCTTGG - Intronic
905118200 1:35660588-35660610 CTGTAAGTCCAGATGGACCTTGG - Intergenic
905246933 1:36621573-36621595 CTGTGAATACAGATGAGGCTTGG + Intergenic
905378118 1:37538872-37538894 CTGAAAATATAGATGAAGTTTGG - Intronic
905705860 1:40057041-40057063 CTATAAATACAAATGAAATATGG + Intronic
906940561 1:50251785-50251807 CTGTAAATACAGTGGGAACCTGG + Intergenic
907071078 1:51535405-51535427 CTTTAAAGACAGAAGAAACTAGG - Intergenic
907445661 1:54506269-54506291 CAGAAAATACAGAGGAAACTGGG - Intergenic
907789173 1:57645072-57645094 CTGTGGATCCAGATGAACCTTGG - Intronic
908161288 1:61410953-61410975 CTGATAATACAGAAGACACTTGG - Intronic
908263112 1:62353924-62353946 CTGTATTTCCAGCTGAAACTGGG - Intergenic
908377180 1:63555467-63555489 TTGTATATAGAGATGAAACAGGG + Exonic
908822472 1:68102604-68102626 CAGCAAATACAGATGAATATAGG - Intronic
909335139 1:74464658-74464680 CTGTGTACACAGATGAGACTGGG - Intronic
910179003 1:84461155-84461177 CTGTAAGTCCAGTTGAAATTGGG + Intergenic
911501110 1:98685625-98685647 CTTAAAATACAGATTATACTAGG - Intronic
911590243 1:99739038-99739060 ATGTAAAGACAGATCATACTAGG + Intronic
911615752 1:100008985-100009007 CTGTAAGTACAGATGACTCCTGG + Intronic
914330860 1:146670089-146670111 ATTTAAATGCAGATGACACTTGG + Intergenic
915444768 1:155968327-155968349 CTGTAAATCCCTATGAAACTTGG - Intronic
916791469 1:168129113-168129135 CTGTAAAGAAAGATCAAACAGGG + Intronic
916874804 1:168958018-168958040 CAGTAAATACAAATGAAGCTTGG + Intergenic
917103979 1:171473756-171473778 ATGTAAATACAGATCACACATGG + Intergenic
917429726 1:174953523-174953545 CTGTCATTACAGATGAGAGTGGG - Intronic
918484531 1:185015301-185015323 CTGGAAATACAGATGCAGATTGG - Intergenic
918656638 1:187034993-187035015 CTGGAAATATAATTGAAACTTGG - Intergenic
919664541 1:200279408-200279430 AAGTAAATAAAGATGAAATTTGG + Intergenic
920510402 1:206547315-206547337 CTGTAAATACAGATGAAGCGTGG - Intronic
922287235 1:224181088-224181110 CTGCCAATCCAGATGAAACTTGG + Intronic
922289491 1:224198655-224198677 CTGCCAATCCAGATGAAACTTGG - Intergenic
922382989 1:225052180-225052202 CTTTGAATACAGATGAATATTGG + Intronic
1063506157 10:6601597-6601619 CTGTGAACACAGATGAAGTTTGG + Intergenic
1063618901 10:7626750-7626772 CTCTGAATTCAAATGAAACTGGG + Intronic
1064635993 10:17367460-17367482 CTGTAATTCAAGATGAGACTTGG + Intronic
1065160473 10:22915830-22915852 CTGCAATTACACATGGAACTTGG + Intergenic
1067467028 10:46508762-46508784 CTGTAAATGCTGATGAGGCTGGG + Intergenic
1067620158 10:47875843-47875865 CTGTAAATGCTGATGAGGCTGGG - Intergenic
1069848317 10:71388523-71388545 GGGTAAATACAAATGAATCTTGG - Intergenic
1070012238 10:72487435-72487457 CTGTAACCACAGATGAAACATGG + Intronic
1074051715 10:109886732-109886754 CTGTAAATACTGATGCAACAGGG + Intronic
1076815621 10:132913388-132913410 CTGTAAATGCAGATGGAGTTTGG - Intronic
1077073778 11:690386-690408 CAGTAAAAACATAAGAAACTTGG - Intronic
1077440664 11:2567268-2567290 CTGCAAATACAGATGAACCCAGG + Intronic
1078566304 11:12417690-12417712 CTGTAAATACAAACTTAACTTGG - Intronic
1079892482 11:26074056-26074078 CTCTAGAGACAGATGTAACTTGG + Intergenic
1080179405 11:29405874-29405896 CTGCAAATCTAGTTGAAACTGGG + Intergenic
1080785554 11:35472055-35472077 AAGTAAACACTGATGAAACTCGG - Intronic
1081730507 11:45368801-45368823 CTGTTAAGACAGATGAAAATGGG + Intergenic
1082134754 11:48534316-48534338 CTGAAAACACAGAAGTAACTGGG - Intergenic
1082613198 11:55327699-55327721 CTGAAAAGACAGAAGTAACTGGG - Intergenic
1084455686 11:69266923-69266945 CTGTAAATACAGATGAAGCTTGG - Intergenic
1085087590 11:73681290-73681312 CTGAGAATACAGATGTAACAAGG + Intronic
1086596103 11:88573006-88573028 CTAGAAATGCAGATGAAACATGG + Intronic
1086605679 11:88693509-88693531 CCATAAATACCGATGACACTAGG + Intronic
1086859172 11:91904697-91904719 ATGGAAATACATATGAAACAAGG - Intergenic
1088030529 11:105243138-105243160 ATATAAATATAGATCAAACTTGG + Intergenic
1089885511 11:121818856-121818878 CTGTAAATACACAAAAAACTAGG - Intergenic
1090367194 11:126216464-126216486 CTGTAAAGACAGAGGAAAAGAGG - Intronic
1092961399 12:13599758-13599780 CTGTAAATAGATTTGAAATTTGG + Intronic
1093125234 12:15321400-15321422 CTGTACATACCGTTGACACTTGG + Intronic
1094457262 12:30650439-30650461 ATGTAAATACAGTTGACTCTTGG - Intronic
1098145793 12:67496686-67496708 CTGCAAATAAATATGACACTGGG - Intergenic
1098373875 12:69791226-69791248 CTGTAAACTCAGAAGAAACAAGG + Intronic
1098547245 12:71725350-71725372 TTGTAACTAGAGATGAAACATGG - Intergenic
1098566693 12:71945261-71945283 CTGTAAAGAAATATGATACTTGG + Intronic
1099043570 12:77686741-77686763 CTGTAAAGTCAGATGAACCTAGG - Intergenic
1100032702 12:90212501-90212523 CTGGAAAGAAAGATGAAACTTGG - Intergenic
1101521903 12:105491602-105491624 GTGAAAACACAGATGAACCTGGG - Intergenic
1101851842 12:108409571-108409593 CTGTTAATACTGATGAAAAGGGG - Intergenic
1101894661 12:108746955-108746977 ATGTTAATACAGAGGTAACTGGG + Intergenic
1103430572 12:120881746-120881768 CGCTAAATATAGATGAAGCTCGG + Intronic
1103626095 12:122221204-122221226 CTTTAAATAGAGGTGAGACTTGG + Intronic
1103738240 12:123074222-123074244 CTGTTAAATCAGATGAGACTTGG + Intronic
1105285177 13:18997590-18997612 CTGAAAATAGAGATGAACATAGG - Intergenic
1106433000 13:29699456-29699478 CTGTGAATCCATCTGAAACTGGG - Intergenic
1106553688 13:30792346-30792368 CTGTACATAAAGATGACACTGGG + Intergenic
1107100206 13:36582201-36582223 CAGTAAATACAGTAGGAACTAGG - Intergenic
1107982010 13:45742957-45742979 CTCTAACTACAGATGACTCTTGG + Intergenic
1108215802 13:48183177-48183199 CTGTAACAAGAGATGAAACATGG + Intergenic
1109430538 13:62228202-62228224 CTTTAAATTCAGATGATAATAGG - Intergenic
1109685980 13:65819921-65819943 CTATAAATAAAGATGAGATTTGG - Intergenic
1109982142 13:69923232-69923254 CGTTAAATACTGATGAAAATTGG + Intronic
1110103997 13:71647131-71647153 CTGTTAATAAAAATGATACTTGG + Intronic
1110527559 13:76556491-76556513 CTATAAGCATAGATGAAACTTGG - Intergenic
1111538171 13:89631360-89631382 CAGAAAATACAGATGAAAGAAGG - Intergenic
1112347738 13:98604978-98605000 GTGAAAATACAGAAGAAAATGGG + Intergenic
1112582596 13:100689375-100689397 CTGTAAAGATACATGAAAATGGG + Intergenic
1112757193 13:102649778-102649800 ATGTAAATACAAATCAAACTTGG + Intronic
1112814462 13:103255460-103255482 ATGTAGATTCAGATGTAACTTGG + Intergenic
1112921036 13:104613055-104613077 CAGCAAGTACAGGTGAAACTGGG + Intergenic
1113247220 13:108411092-108411114 CTGTAAATACAGATGACCCTTGG + Intergenic
1114879115 14:26761784-26761806 CTGCAAATACAGACTAAGCTTGG - Intergenic
1115541104 14:34422200-34422222 CTGTAAAGAAAGATGACACCTGG + Intronic
1115943160 14:38630617-38630639 CTATAAATCCAGATGAGATTTGG + Intergenic
1116172409 14:41420337-41420359 CTGCAAATACAGATATAATTGGG - Intergenic
1116992479 14:51291014-51291036 CTGCAAATACAGATTAACATTGG - Intergenic
1117630951 14:57690884-57690906 CTCTAAATACAGATGAAGCTTGG + Intronic
1119083376 14:71717928-71717950 CTGTAGGTACTGATGTAACTGGG - Intronic
1120347126 14:83305175-83305197 TTGTAAATAGAGAACAAACTTGG - Intergenic
1122078579 14:99251596-99251618 CTGTAAATTCAGGTGCACCTGGG - Intronic
1124792504 15:32742490-32742512 CTGTAAATAAAAATGCCACTGGG - Exonic
1125135183 15:36333047-36333069 CTGTAAATATAGATGAAACTTGG - Intergenic
1125375133 15:39020770-39020792 CTCAAAATAAATATGAAACTAGG - Intergenic
1125442850 15:39722048-39722070 CTGCAAATACAGTTGAACTTGGG - Intronic
1126292819 15:47100356-47100378 CAGGAATTAGAGATGAAACTGGG - Intergenic
1127061142 15:55186817-55186839 CTGGAAATACATATTAAACTAGG + Intronic
1127063550 15:55213562-55213584 CTGTAAATACAGATGAAACTTGG - Intronic
1133214236 16:4281651-4281673 CTGTAGATACAGATGAAGCTTGG + Intergenic
1134379043 16:13707402-13707424 CTGTAAATACAGATGAAGCTTGG - Intergenic
1135280312 16:21148667-21148689 CTGTAGAAACAAATTAAACTAGG + Intronic
1139158214 16:64470415-64470437 CTGGAAATACAGATCTACCTTGG + Intergenic
1139508126 16:67409825-67409847 ATGTAAACACAGATGAGACCGGG + Intronic
1140002694 16:71040817-71040839 ATTTAAATGCAGATGACACTTGG - Intronic
1140579644 16:76214603-76214625 ATGTAAGTACAGATGAAAATGGG - Intergenic
1141350178 16:83287401-83287423 CTGTAAATACAGATGAAGCTTGG - Intronic
1143060995 17:4200958-4200980 CTGTATATTCAAATGAAAATGGG - Intronic
1146471024 17:33125046-33125068 CTGTAAACACAGATGAAGCTTGG + Intronic
1148570001 17:48660651-48660673 CTGTTCACACAGATAAAACTAGG - Intergenic
1149149056 17:53537107-53537129 CAGTAAATACAGTAGAAATTAGG - Intergenic
1149975342 17:61260132-61260154 CTGTAAATAAAGTGGAAACAGGG - Intronic
1150054256 17:61997767-61997789 CTGTAGAGACAAATAAAACTCGG + Intronic
1150121653 17:62608465-62608487 CCCTGAATACAGATGAAGCTGGG - Intronic
1150455865 17:65305995-65306017 CTGTAAATACAGATGAAGCTTGG + Intergenic
1151416741 17:73971243-73971265 CTGTAAATACCCATGAATCTGGG - Intergenic
1153990941 18:10399842-10399864 CTGTAAATATCTATGAAAATAGG + Intergenic
1154070316 18:11147572-11147594 CTGTAAATACAGTTACTACTTGG + Intronic
1154350366 18:13578147-13578169 CCGTAACTACACATGAGACTTGG - Intronic
1155367005 18:25058719-25058741 CTGTAAATACAGATGAAGCTTGG + Intergenic
1156648533 18:39197154-39197176 CTATAAGCACAGATGAAGCTTGG + Intergenic
1157020772 18:43778923-43778945 ATGTAACCAGAGATGAAACTAGG + Intergenic
1158099617 18:53815732-53815754 CTGTAAATACAGATTTAAAATGG - Intergenic
1158102847 18:53850009-53850031 TTGTAAACTGAGATGAAACTAGG + Intergenic
1158390003 18:57037224-57037246 CTGGAAACACAGAGGAAACTGGG - Intergenic
1159514110 18:69435361-69435383 ATGTAAATACAGATAAAATATGG + Intronic
1160032881 18:75278140-75278162 CTGAAAAGACAGAGTAAACTGGG - Intronic
1163493127 19:17628683-17628705 CGGTTAACACAGATGAAACATGG + Intronic
1166352996 19:42209437-42209459 CTGAATACACAAATGAAACTAGG + Intronic
1168612291 19:57811068-57811090 CAGTAAATACTGAAGGAACTCGG + Intronic
925682610 2:6438712-6438734 CAGTAAATACAGATGCCACTTGG - Intergenic
925758516 2:7159396-7159418 ATATACATACAGATGAAACATGG - Intergenic
926130238 2:10298399-10298421 CTGTAATTACAAATGAAACTGGG + Intergenic
928654001 2:33430450-33430472 CTGTAAATCAGGTTGAAACTAGG - Intergenic
929148757 2:38729496-38729518 CTCTATATAAAGATGAGACTTGG + Intronic
930156792 2:48114123-48114145 CTGAAAACAGAAATGAAACTAGG - Intergenic
930351382 2:50259958-50259980 CTGCATGTACAGATGAAATTGGG + Intronic
930654776 2:53997070-53997092 CTGTAAATACAAACGAATATTGG - Intronic
931617771 2:64177977-64177999 CTGCAAATACACTTGAAAATGGG + Intergenic
933227851 2:79771719-79771741 AAATAAATACAGATGAAGCTTGG + Intronic
933602707 2:84349151-84349173 CTCTAAAGACAGAAGAAAATGGG + Intergenic
935824723 2:106934102-106934124 GTGGAAATACAGATGGACCTTGG - Intergenic
936750039 2:115631014-115631036 CTGTAAATACATCTGATCCTGGG + Intronic
936980405 2:118259430-118259452 CTGTATATAGAAATGTAACTTGG + Intergenic
937638236 2:124181098-124181120 ATGTGAACACAGAAGAAACTTGG - Intronic
938440286 2:131324285-131324307 CTGAAAATACTTAAGAAACTTGG - Intronic
939306319 2:140416092-140416114 TTGTGAATACAGATGAAGCTTGG - Intronic
943785287 2:191870987-191871009 CTGAAAACAGAGATGGAACTGGG + Intergenic
943814006 2:192228206-192228228 TTGTAAAAACAGAAGAAATTTGG + Intergenic
944361086 2:198857581-198857603 CTGTAAATGTAGATGAAATTAGG + Intergenic
945759030 2:213888566-213888588 ATGTAAGTACACATGAAAGTTGG + Intronic
946132956 2:217621877-217621899 CTGTAAATGCAGTGGAAGCTGGG + Intronic
946523480 2:220492450-220492472 CTCCTAATACAGATGATACTCGG - Intergenic
1169875398 20:10291786-10291808 ATGAAAATACAGATGAAAAGAGG + Intronic
1170299537 20:14867855-14867877 CGGTCATTAAAGATGAAACTGGG - Intronic
1171394158 20:24820264-24820286 CTGTAAACACTGATGCCACTTGG + Intergenic
1174795298 20:53517306-53517328 CTGTAAACACAGATGAAGCTTGG - Intergenic
1175604026 20:60297847-60297869 CTGTAAACACAGATGAAGCATGG + Intergenic
1176229254 20:64023373-64023395 CTGTAAATGCTGATTAAATTTGG + Intronic
1177507130 21:22033761-22033783 ATATAATAACAGATGAAACTTGG - Intergenic
1177852316 21:26363334-26363356 AAGTAAATACAGATGAAAACAGG + Intergenic
1178475062 21:32930892-32930914 CTGTAAATACAGATGAAGCTTGG + Intergenic
1179559052 21:42201201-42201223 CTGCAAATACAGATTAACATTGG - Intronic
1181829582 22:25549258-25549280 CTGTAAATACAGATGAAGCTTGG - Intergenic
1183738318 22:39656115-39656137 ATGTAATTACAGATGGAAATGGG + Intronic
1184643447 22:45884037-45884059 CTGTAATTTCAGATGTAGCTGGG + Intergenic
1184964620 22:47962138-47962160 TTGAATATACAGATGAATCTGGG - Intergenic
949690655 3:6633743-6633765 CTGCAAACACAGCTGTAACTAGG + Intergenic
952124596 3:30285764-30285786 AAGTAAATAAATATGAAACTAGG - Intergenic
954172317 3:48814616-48814638 CTGGAAATACAAATGGAACAAGG - Intronic
955035480 3:55263185-55263207 GTGCAAAGACAGATGAATCTTGG + Intergenic
955487315 3:59448020-59448042 GTCTAAATACAGACGAAAGTTGG - Intergenic
955514851 3:59716405-59716427 TTGTAAATAGGGATGAAACCAGG - Intergenic
955727805 3:61951599-61951621 CTGGAAATACACAGGAAATTAGG - Intronic
956932544 3:74061263-74061285 ATGTCAATACAGAACAAACTAGG + Intergenic
957330928 3:78762412-78762434 CTGGAAATATAAATGAAATTAGG - Intronic
957618878 3:82569353-82569375 CTGTAAATAGAAATCAAACTGGG - Intergenic
958028393 3:88076379-88076401 CTGTACTTAAAGATGAAAATGGG - Intronic
959854737 3:111138380-111138402 TTTTAAAAACAGATGAAAGTTGG - Intronic
963076854 3:141355260-141355282 CTCTAAAATCAGATTAAACTTGG + Intronic
965447665 3:168795658-168795680 CTTTAAAGACAGAAGATACTTGG - Intergenic
967635976 3:191803735-191803757 CTGTAAAAGAAGATTAAACTGGG + Intergenic
967637726 3:191823696-191823718 CTGTAAATTCATATGATACTGGG - Intergenic
968198975 3:196735896-196735918 TTTTAAATACTGATGAAACCTGG - Intronic
970180928 4:13392470-13392492 AGGTAAATACAGAAGAAACTTGG + Intronic
970480991 4:16474325-16474347 TTGTAACAAGAGATGAAACTTGG + Intergenic
971837391 4:31786161-31786183 CTGTAAATACAGATAAAGCTTGG - Intergenic
972100710 4:35411806-35411828 ATGTAAATAAAGATGATATTGGG + Intergenic
972184994 4:36517915-36517937 CTGTAAATTCAGATAAGCCTGGG + Intergenic
973066513 4:45800859-45800881 ATGAAAATACAAATGAAAGTTGG - Intergenic
973992222 4:56421042-56421064 CTGTAAATACAGATGAAGCTTGG - Intronic
974715451 4:65664433-65664455 TTGTAAACACAGATTAAAATGGG - Intronic
977428815 4:96904997-96905019 TTGAAACTACAGATTAAACTGGG - Intergenic
977438600 4:97034145-97034167 TTTTAAATAAAGATGAAAATTGG + Intergenic
977910147 4:102524891-102524913 CTGTATATACAGATGAAGCTTGG + Intronic
978316127 4:107439479-107439501 CTGCAAATACAGATTAACATTGG - Intergenic
978347276 4:107784955-107784977 ATGGAAATACAGAGAAAACTTGG - Intergenic
979306930 4:119156384-119156406 CTTTAAAAACTGATGAGACTAGG + Intronic
979464903 4:121025389-121025411 CTGTAAATACACATAAAATCAGG + Intergenic
979623458 4:122821330-122821352 CTGCAAATACAGATTAACATTGG - Intergenic
980679193 4:136134209-136134231 TTGTACATACATATGAAAATAGG + Intergenic
981182651 4:141763963-141763985 CTGTAAATACACATGAAGCTGGG + Intergenic
981359743 4:143832361-143832383 CTATAAATCAAGATGAAATTTGG - Intergenic
981980094 4:150781474-150781496 CTATAAATACAGATGAAGCTTGG + Intronic
982039959 4:151387556-151387578 CTGCAAATACAGATTAACATTGG - Intergenic
983888192 4:173004280-173004302 CTGGAAAGACAGAAGACACTAGG - Intronic
984248998 4:177309650-177309672 CTGTAAAAGCAGAAGAAATTGGG - Intergenic
984601577 4:181733067-181733089 CTGAAAATGCAGATGAAGGTTGG + Intergenic
986056344 5:4140827-4140849 CTGTAATTCAAGATGAAATTTGG + Intergenic
987795404 5:22621862-22621884 CTGTAAAAACACAAAAAACTAGG + Intronic
988150260 5:27368270-27368292 CTGTAAATACGGAGGGAGCTTGG + Intergenic
988717501 5:33842638-33842660 CTGGAAAAACAGAGGAAAGTGGG + Intronic
989076573 5:37569943-37569965 CTGGAAATACAGAAGAAATAGGG + Intronic
989153354 5:38321345-38321367 CTGTAAATACAGACGAAGCTTGG + Intronic
991316654 5:65316477-65316499 ATGTAATTACAGATATAACTAGG - Intronic
992362366 5:76053217-76053239 CTGAAAAGACAAATGACACTTGG - Intergenic
994671479 5:102766515-102766537 CTGTAAATACAGATGAAGCTTGG + Intronic
995405698 5:111793100-111793122 CTGTAAATTCAAATGAAACATGG + Intronic
998770774 5:145542315-145542337 CTGGAAATACAATTGTAACTAGG - Intronic
999504520 5:152181050-152181072 CTGTAAAGACATCTGAGACTGGG + Intergenic
1000362572 5:160461595-160461617 TTGTAAATACAGGTAAAACTTGG + Intergenic
1000614534 5:163412763-163412785 ATGTAAATTCATATGAAACTAGG - Intergenic
1000774313 5:165398821-165398843 TGGTAACTACAGATGAAAGTGGG - Intergenic
1000966203 5:167659957-167659979 CTGTAAATACACCTGAAATAAGG + Intronic
1002291975 5:178206168-178206190 ATGAAAATACAGATTAAGCTGGG + Intronic
1002713840 5:181212763-181212785 CTGTAAGAGCAGATGAAATTCGG - Intergenic
1004327268 6:14686698-14686720 CTGTAAAAACAGATGAAGCCTGG + Intergenic
1004452748 6:15762180-15762202 CTGAAAATTCAAATGTAACTGGG - Intergenic
1004952225 6:20686314-20686336 CTGTAAACACAGATGAAGCTTGG - Intronic
1005051251 6:21685874-21685896 CTGTAAACACAGATGAAGCTTGG - Intergenic
1008041481 6:46805778-46805800 CCTTAAAGACAGAAGAAACTTGG - Intronic
1010258540 6:73789054-73789076 CTGTAAATACAGAAACATCTGGG + Intronic
1010898600 6:81398087-81398109 CTGTAAATACAGGCAAATCTTGG - Intergenic
1011508724 6:88076870-88076892 CTATAAAAAGAGATTAAACTTGG - Intergenic
1012350710 6:98246689-98246711 CTCTAGATTCAGATGAAACTTGG + Intergenic
1012470196 6:99564089-99564111 CTGTTAATACAAATGGAAATTGG - Intronic
1012768121 6:103395817-103395839 CTGTAATTCAAGATGAAATTTGG - Intergenic
1014893371 6:126870034-126870056 CTGTGAATGCAGATGATACTGGG - Intergenic
1014927009 6:127284475-127284497 CTTTAAATAAATATGGAACTTGG + Intronic
1016047962 6:139499719-139499741 CTGTCAATATAGAGGAAACAGGG - Intergenic
1016841397 6:148529110-148529132 CTGTGAAAACAGATGAAGCTTGG + Intronic
1017046173 6:150349026-150349048 GTGTCATTACAGATGTAACTAGG - Intergenic
1017661808 6:156682229-156682251 CCACTAATACAGATGAAACTTGG + Intergenic
1018968130 6:168504574-168504596 CTGTAAATACAGATGAATACAGG + Intronic
1020184334 7:5947411-5947433 CTGTAAAAACAGATGAAGGTAGG + Intronic
1020298583 7:6777355-6777377 CTGTAAAAACAGATGAAGGTAGG - Intronic
1021426322 7:20503539-20503561 CTAGAAAGACAGATGAAAGTTGG + Intergenic
1023935703 7:44738299-44738321 GTGTTTATACAGATGGAACTGGG - Intergenic
1024467361 7:49726115-49726137 ATGCAAATACAAATGAATCTAGG - Intergenic
1025738599 7:64176889-64176911 CAGTAAAAAGAGATGAAAATTGG + Intronic
1026316025 7:69228396-69228418 CTGCAAATACAGATGAAGCTTGG + Intergenic
1026531400 7:71200602-71200624 GTTTAAATAAAGATGGAACTAGG - Intronic
1029047641 7:97646575-97646597 CTGTAAATACAGATGATACTTGG + Intergenic
1030025447 7:105319699-105319721 CTGTAAATACAGCTGAGTCCTGG + Intronic
1031376486 7:121032950-121032972 CTTTAGATACAGAGGAAGCTGGG - Intronic
1031828739 7:126600234-126600256 CTGGAAATACAGTTGACCCTTGG + Intronic
1033549274 7:142431814-142431836 CAGTAAGAACAGATGGAACTGGG + Intergenic
1034288768 7:149910504-149910526 CTGGAAATAAAGTTGAAACGCGG + Intergenic
1034662309 7:152782362-152782384 CTGGAAATAAAGTTGAAACGCGG - Intronic
1036545266 8:9762600-9762622 CTGTAACAACAGATAAAATTGGG + Intronic
1037096169 8:14990397-14990419 CTGAAAGTACAGATGCAGCTTGG - Intronic
1038657330 8:29465761-29465783 CTGTAAATATAGATGAAGCTTGG - Intergenic
1038863630 8:31414846-31414868 CTGTAAATACAGATGATGCTTGG + Intergenic
1041128041 8:54665682-54665704 CTCTAAGAACTGATGAAACTGGG - Intergenic
1042230955 8:66553996-66554018 CTTTATATACAAATGAAACTAGG + Intergenic
1042522233 8:69725827-69725849 CTGAAAATCCAGAGGAAACAAGG - Intronic
1043115113 8:76241265-76241287 TTGTAACCACAGATGAAACATGG - Intergenic
1043325733 8:79048775-79048797 TAGTTAATACAGAGGAAACTGGG + Intergenic
1044086204 8:87945125-87945147 CTGGAAACACAGAAGAAACTTGG + Intergenic
1045076418 8:98574073-98574095 CTATAATTAAAGATGAAATTTGG + Intronic
1045756886 8:105554228-105554250 CTCAAAATGCAGATGAAACATGG + Intronic
1046639421 8:116710364-116710386 CTGAAAATACAGATCAAGCTGGG - Intronic
1051045723 9:12871139-12871161 CTGAAAATACAGAAGTAGCTTGG + Intergenic
1051161748 9:14216445-14216467 CTGTGGATACAGATGCACCTTGG - Intronic
1051857710 9:21588439-21588461 CTGTAAATACAGAAAATAATAGG - Intergenic
1052294672 9:26883224-26883246 CTGTAATTCCAGATGAGATTTGG - Intronic
1052647676 9:31256816-31256838 CTGTAAAAACAGGTGATAGTCGG - Intergenic
1052707173 9:32008145-32008167 CTGTGAATCCATATGAACCTGGG + Intergenic
1053525883 9:38830122-38830144 CTTTAAAAACAGAAGAATCTGGG + Intergenic
1054198114 9:62054547-62054569 CTTTAAAAACAGAAGAATCTGGG + Intergenic
1054640240 9:67533816-67533838 CTTTAAAAACAGAAGAATCTGGG - Intergenic
1056695140 9:88842320-88842342 CTGTAAAGTCAGATGAAAGATGG - Intergenic
1058261309 9:102836097-102836119 CTGTATATACAAATTATACTAGG + Intergenic
1058431108 9:104920190-104920212 CTGTAATTACACATAAAATTTGG + Intronic
1059039882 9:110800917-110800939 CGGTGAATACTGGTGAAACTGGG - Exonic
1185740599 X:2529020-2529042 CTGTAAATGCATTTAAAACTTGG - Intergenic
1185878432 X:3718791-3718813 TTTTAAAAACAGCTGAAACTTGG + Intergenic
1186204826 X:7190389-7190411 CTGTAAATACAGATGAAGCTTGG + Intergenic
1187121678 X:16413828-16413850 ATGTAAATACAGTTGACTCTTGG - Intergenic
1188242222 X:27807224-27807246 CTATAAAAACAAATGTAACTTGG + Intergenic
1188289986 X:28375759-28375781 ATGTAAATATACATGAAAATAGG + Intergenic
1189724274 X:43952850-43952872 CTGGAAATACATGTGAAACCTGG - Intronic
1190181854 X:48198967-48198989 CTGAAAATACAGAACAAAATGGG + Intronic
1190194897 X:48308454-48308476 CTGAAAATACAGAACAAAATGGG + Intergenic
1190553187 X:51606285-51606307 CTGTAAAAACAGATGACAGAAGG - Intergenic
1194000257 X:88420075-88420097 CTGTAATTAAAGATGAGATTTGG - Intergenic
1194697545 X:97073237-97073259 CTGTCAGGCCAGATGAAACTTGG + Intronic
1194806546 X:98335811-98335833 CTGTAACTACAGATGAGACCAGG - Intergenic
1195915263 X:109929172-109929194 ATGGAAATACAGAGGAAAATTGG + Intergenic
1196186090 X:112746596-112746618 CTGGACATTCACATGAAACTTGG + Intergenic
1199406914 X:147472876-147472898 TTGTATATAGAGATGAACCTAGG - Intergenic
1200023147 X:153228780-153228802 CTGTACATGCAGTTGAACCTGGG - Intergenic
1201577511 Y:15477023-15477045 CTGTGAATACAGATGAAGCTTGG + Intergenic