ID: 1127066511

View in Genome Browser
Species Human (GRCh38)
Location 15:55245217-55245239
Sequence CTGTCTCCACTTATGGAAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 204
Summary {0: 1, 1: 0, 2: 4, 3: 9, 4: 190}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127066511_1127066516 16 Left 1127066511 15:55245217-55245239 CCCATTTCCATAAGTGGAGACAG 0: 1
1: 0
2: 4
3: 9
4: 190
Right 1127066516 15:55245256-55245278 AGTTTACTCATCTCAACTTCTGG 0: 1
1: 0
2: 0
3: 15
4: 179

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127066511 Original CRISPR CTGTCTCCACTTATGGAAAT GGG (reversed) Intronic
902219144 1:14953794-14953816 CTTTCTCCACTTCTGGGAAGTGG - Intronic
902818441 1:18929198-18929220 CAGTCTCCACTTCTGTAAAACGG + Intronic
903424559 1:23244290-23244312 CAGTCTCCTCATCTGGAAATTGG + Intergenic
904474855 1:30758104-30758126 CTGTTTCCTCATCTGGAAATGGG - Intergenic
904987599 1:34564732-34564754 CTGTCTTCACATTTGAAAATTGG - Intergenic
906285414 1:44584507-44584529 CTGGCTCCAGCTCTGGAAATAGG + Intronic
907566730 1:55442470-55442492 CTGTTTTCACTGAAGGAAATAGG - Intergenic
908824756 1:68122746-68122768 CTCTTTCCACTGATTGAAATGGG + Intronic
910260098 1:85285698-85285720 CTGACTCCAGTCATGGGAATGGG - Intergenic
911666092 1:100554356-100554378 CTTTATCCACTCATTGAAATGGG + Intergenic
913083645 1:115413689-115413711 CTATTTCCACATAAGGAAATTGG - Intergenic
913361799 1:117989323-117989345 CTACTTCCACTCATGGAAATGGG + Intronic
914884136 1:151571307-151571329 CTGTTTCAACTTTTGGAAAAAGG + Intronic
914915412 1:151816265-151816287 CTGTGTCCAAGTATGGGAATGGG + Intronic
915609390 1:156979030-156979052 CTGTCTCCACTTGAAGTAATAGG + Intronic
917599539 1:176560468-176560490 CTGTCTCCGCTATGGGAAATAGG - Intronic
920436879 1:205952785-205952807 CAGTCTCCACATATGCAAAATGG - Intergenic
922331371 1:224579819-224579841 CTGTCTCCAATCATGGCAAATGG - Intronic
924400257 1:243672458-243672480 CTCTCTCCACATAAGCAAATAGG + Intronic
1062964987 10:1600255-1600277 CTGGCTACACTTAGGGAAACTGG + Intronic
1063465802 10:6243523-6243545 CTGCCTCCACTGATGGGACTAGG - Intergenic
1063989063 10:11539892-11539914 CAGTCTCCACATATGTAAAGTGG - Intronic
1068204667 10:53834727-53834749 CTGCCTCCATTGATGGATATGGG + Intronic
1068799778 10:61127039-61127061 CTTTTCCCACTTATGGTAATTGG - Intergenic
1070387323 10:75937583-75937605 GTGTCTTAACTGATGGAAATTGG - Intronic
1073604202 10:104877399-104877421 CTGTATCCTCTTATGTAAAGTGG + Intronic
1073819602 10:107245837-107245859 CTGTCTCCACTCCTTGAAACAGG + Intergenic
1074451807 10:113565414-113565436 CTGCCTCCACTCATGGCAAAAGG + Intronic
1077599609 11:3565138-3565160 CAGTCTCCTCTTCTGGAAAGTGG - Intergenic
1078550848 11:12279718-12279740 CTGTCTCCACACATGGAACTCGG + Intronic
1080718799 11:34829555-34829577 ATGTCTCCTTTTTTGGAAATAGG - Intergenic
1082081679 11:48017067-48017089 CTGTTTCCACTTGTAAAAATGGG - Intronic
1084255515 11:67939743-67939765 CAGTCTCCTCTTCTGGAAAGTGG - Intergenic
1084906710 11:72354064-72354086 CTTTCTCCTCATCTGGAAATGGG - Intronic
1084994142 11:72958888-72958910 CTGTTTCCATAGATGGAAATGGG - Intronic
1085088543 11:73690055-73690077 CTGTATTAAATTATGGAAATAGG - Intronic
1087758096 11:102075441-102075463 CTCTCTCCTCTTATGGATTTTGG - Intronic
1088108403 11:106230818-106230840 CTTTCTCCAATAATGGTAATAGG + Intergenic
1089654564 11:119937448-119937470 CTATTTCCACTTCTGAAAATGGG + Intergenic
1091397628 12:163407-163429 CTGTCTCCTCTTCTGGAAAATGG + Intronic
1092425751 12:8374477-8374499 CAGTCTCCTCTTCTGGAAAGTGG - Intergenic
1096785040 12:54012043-54012065 CTATCTACCCTTCTGGAAATGGG - Exonic
1102440740 12:112962403-112962425 GTGTCTCCCCTCAAGGAAATTGG - Intronic
1104176523 12:126338341-126338363 CTGTATCCACTGATGGTTATCGG + Intergenic
1106717229 13:32403761-32403783 CTGGTTCCTCTTATGGTAATAGG - Intronic
1107300276 13:38958721-38958743 CAGACTCCAGTTATGAAAATTGG + Intergenic
1108932065 13:55837502-55837524 CTGTTTCCTCATCTGGAAATGGG + Intergenic
1108974953 13:56429305-56429327 CAGACTCCACCTATGGAAAATGG - Intergenic
1111740214 13:92195572-92195594 CTGACACCACGTATGTAAATGGG + Intronic
1111740537 13:92199423-92199445 ATGTCTCCAGTTATAGAAAATGG + Intronic
1112688324 13:101859263-101859285 CTGTCACTACTTGAGGAAATGGG + Intronic
1114690070 14:24573332-24573354 CTGTGTCCACATATGGCAAAAGG - Intergenic
1117095724 14:52295482-52295504 CTGTCAATAATTATGGAAATGGG + Intergenic
1121646791 14:95523827-95523849 CTGTCTCCACATTTAGAAAATGG + Intergenic
1126618223 15:50608547-50608569 CTGTCTCCACTGATGAAAATAGG - Intronic
1126646638 15:50881538-50881560 TTGTCTCTACTTAAGGAAGTTGG + Intergenic
1126744477 15:51812248-51812270 CAGTCTTCCCTTAGGGAAATTGG - Exonic
1127066511 15:55245217-55245239 CTGTCTCCACTTATGGAAATGGG - Intronic
1129266019 15:74393544-74393566 CTGTCTCTTCTTCTGGAAACAGG - Intergenic
1130134958 15:81174710-81174732 CAGTCACCACTTTTGGACATAGG + Intronic
1131348171 15:91670961-91670983 CTTTACCCACTCATGGAAATGGG + Intergenic
1133372588 16:5256441-5256463 CAGTCTCCTCTTCTGGAAAGTGG + Intergenic
1137661016 16:50206500-50206522 CTGACTTCAGTTATGGAACTGGG + Intronic
1137757792 16:50916461-50916483 CAGTCTCCTCGTCTGGAAATTGG + Intergenic
1138467565 16:57203003-57203025 CTGTCTAAAATAATGGAAATAGG + Intronic
1140113926 16:72025696-72025718 CTGTCTCCACGGTGGGAAATGGG - Intronic
1140941517 16:79725774-79725796 CTGTTTCCTCCTATGGAAAATGG + Intergenic
1141007403 16:80365161-80365183 CTGTTTCCACATCTGGAAAATGG - Intergenic
1143559502 17:7684489-7684511 CTGTCTCCACTTGTTGAAATAGG - Intronic
1147880090 17:43647791-43647813 CTGTTTCCTCTGCTGGAAATCGG - Intronic
1150644755 17:66971083-66971105 CTGTCTCCTCATCTGAAAATGGG + Intronic
1150924511 17:69518441-69518463 TTGTCTCCATTTGTGGAAAAAGG + Intronic
1155203519 18:23537580-23537602 CAGTCTCCTCTTCTGTAAATGGG + Intronic
1167937665 19:52921114-52921136 CTGTCACCATTTAGGGACATAGG + Intergenic
925269136 2:2589973-2589995 CCCTCTCCACCTATGGAACTAGG - Intergenic
925740773 2:7004284-7004306 CTTTCCCCACTTATGGACAGGGG - Intronic
927178064 2:20424283-20424305 CAGTTTTCACTTCTGGAAATGGG - Intergenic
928045174 2:27924101-27924123 ATGATTCCACTTATGGAAAAAGG - Intronic
931013378 2:57944983-57945005 CTGTTTCCTCATATGTAAATTGG - Intronic
935170934 2:100611139-100611161 CGGTCTCCCCTCATGGAAAATGG + Intergenic
935614690 2:105065043-105065065 CTGTCTCCACTGATAGAATGAGG + Intronic
935802456 2:106712412-106712434 CTGTCTTCACTTCTGGATGTGGG - Intergenic
936827422 2:116599398-116599420 CTGTTTCCTCTTGAGGAAATAGG - Intergenic
941483323 2:166045756-166045778 CTTTCTCTAGTTATTGAAATTGG + Intronic
942508749 2:176673099-176673121 CAGTTTCCTTTTATGGAAATAGG + Intergenic
943720521 2:191199198-191199220 CCGTCTCCTCATATGGAAGTAGG - Intergenic
943732261 2:191314874-191314896 CTGACTCATATTATGGAAATAGG - Intronic
943843393 2:192608024-192608046 CTATTACCACTTATGGAAAAGGG - Intergenic
945377514 2:209096721-209096743 CTGTCTCCACTTAGGGCTGTTGG - Intergenic
946126996 2:217571579-217571601 CTCTCTCCACTTAGAGAATTGGG - Intronic
948094865 2:235325412-235325434 TTGTCTCCACTTATGGAAAAGGG + Intergenic
1170595203 20:17800207-17800229 CAGTGTCCAGTTAGGGAAATAGG + Intergenic
1171350780 20:24501636-24501658 CTGTTCCCTCTTCTGGAAATGGG + Intronic
1172512756 20:35511985-35512007 CTGTCTCCACTTGTGCAGCTGGG + Exonic
1173177456 20:40775146-40775168 CAGTCTCCACTTCTGAAAAATGG + Intergenic
1173577064 20:44119359-44119381 TTCTCTTCAATTATGGAAATAGG - Intronic
1174866478 20:54141399-54141421 CAAACTCCACTTATTGAAATGGG - Intergenic
1175042506 20:56068221-56068243 CTGCCTCCATTTCTGGAAAATGG + Intergenic
1176104899 20:63381317-63381339 CTTTCTCCTCTGATGGAAGTCGG - Intergenic
1181085047 22:20436093-20436115 CTGTCTCCACCTCTGTAAAATGG - Intronic
1184142728 22:42587685-42587707 CTGGCTCCACAGATGGAGATGGG + Intronic
1184415201 22:44348109-44348131 CTGCCTCCTCATATGGAAACGGG - Intergenic
1184430312 22:44438472-44438494 CTGTCTCCACCTGGAGAAATGGG - Intergenic
1185120100 22:48960897-48960919 CTGTAACCACTTAAGGAAGTGGG - Intergenic
950127926 3:10521893-10521915 CAGTCTCCTCTTCTGTAAATGGG - Intronic
950480173 3:13239016-13239038 CTGTCTCCGCTTGAGGACATGGG + Intergenic
950751015 3:15128011-15128033 CAGTCTCCTCTTCTGGAAAGTGG + Intergenic
951839934 3:27023535-27023557 CTGTCTCATCTTGAGGAAATGGG + Intergenic
952752316 3:36834872-36834894 CTGGCTTCGCTTATAGAAATAGG + Exonic
954393208 3:50278343-50278365 CTGTCTGCCCTTGTGGAGATGGG + Intergenic
954637268 3:52077827-52077849 CTATCTCCACGTTTGCAAATTGG - Intronic
956206820 3:66763388-66763410 CTGGCTACACTTCTGGAAACTGG + Intergenic
956467165 3:69530461-69530483 CTGTTTCCACTTATGGTAGAAGG - Intronic
957112667 3:75985243-75985265 CTGTCTTCACTTACGGATATTGG - Intronic
959759631 3:109944983-109945005 CTGTCTCCACATAAGAACATGGG - Intergenic
959956535 3:112244767-112244789 CTGTATCCACAGATGGAATTAGG + Intronic
961283660 3:125782766-125782788 CAGTCTCCTCTTCTGGAAAGTGG + Intergenic
963662918 3:148151250-148151272 TTGTCTTCATTTATGGAAAGAGG - Intergenic
965015962 3:163156819-163156841 CTTTCTCCAGTTATAAAAATGGG - Intergenic
965282423 3:166770953-166770975 CTGTCTCCATTTAGGGCCATGGG - Intergenic
969739938 4:9016980-9017002 CAGTCTCCTCTTCTGGAAAGTGG + Intergenic
969799102 4:9548498-9548520 CAGTCTCCTCTTCTGGAAAGTGG + Intergenic
970412736 4:15825285-15825307 CTGTTTCCACTCATGGAGAAGGG + Intronic
973737944 4:53891000-53891022 CAGTCTCCTCTTTTGTAAATGGG - Intronic
974886815 4:67829407-67829429 CTGTCTCCCCCTATGTATATAGG - Intronic
975809443 4:78151291-78151313 CTATCTCAACTTGGGGAAATGGG - Intronic
975844329 4:78508924-78508946 CTGCCCCCACTGATGGCAATGGG + Intronic
977724897 4:100284598-100284620 CTGTATCCAATTTTGGGAATCGG - Intergenic
981317434 4:143353466-143353488 CTGACTCCACTTTAGAAAATTGG + Intronic
981491097 4:145340323-145340345 CTGTTTCCACATTTGAAAATGGG + Intergenic
985144705 4:186884111-186884133 CTGTCTACACATATGCAAAATGG - Intergenic
985287465 4:188351094-188351116 CTGTCTCCTCTTATCCACATTGG + Intergenic
986425407 5:7626597-7626619 CTGCCTCCACTCATGGATAATGG + Intronic
986592996 5:9390926-9390948 CTGTCTCCACATCTGCAAAATGG - Intronic
987333296 5:16875758-16875780 CTGCCTCAAATTATGGAAACTGG + Intronic
988942938 5:36164211-36164233 CAGTCTCCCCATATGTAAATGGG + Intronic
988972592 5:36484459-36484481 CAGTCACCACTTATGGCAACTGG - Intergenic
990957879 5:61361967-61361989 ATGTTTTCACATATGGAAATAGG + Intronic
993850862 5:93006817-93006839 ATGTGTCCTCTTATGGAAAAGGG + Intergenic
993974974 5:94468247-94468269 ATGTTTCCTCTTATGCAAATTGG - Intronic
994682288 5:102903669-102903691 CTGTTTCCTCTTCTGAAAATTGG - Intronic
997715428 5:136039261-136039283 CTGTCTCCTCATCTGTAAATGGG - Intronic
998099370 5:139419368-139419390 CTGTCTCCAGAGAGGGAAATAGG + Intronic
999227490 5:150038490-150038512 CTGTCAGAACTTATGGAACTTGG - Intronic
999845485 5:155474947-155474969 CAGTCTCCACTTGTGTAAAACGG + Intergenic
1000932623 5:167270464-167270486 CAGTTTCCACTTCTGGAAAGTGG - Intergenic
1002654926 5:180738517-180738539 TTGTGTCCACTTATGGAGAGTGG - Intergenic
1002885546 6:1290482-1290504 CTGTCTCCATTTATTGATGTGGG + Intergenic
1004812040 6:19272512-19272534 TTGTCCCCACTTATAGGAATAGG - Intergenic
1007104749 6:39275883-39275905 CTGTCTGCACTTGTGGAATTAGG + Intergenic
1007184884 6:39961323-39961345 ATTCCTCCACTTATGGACATAGG - Intergenic
1008491218 6:52089117-52089139 CTGTCTCCTCATAAGAAAATTGG - Intergenic
1009958348 6:70485535-70485557 CTGTATCCACTTATTAAAACTGG - Intronic
1010388154 6:75306009-75306031 CTGTCTTCACAAATGGAAGTTGG + Intronic
1010445384 6:75943496-75943518 CTGTTTCCACTCATGGCAAAAGG - Intronic
1015389726 6:132668004-132668026 ATGTCTCCACATGTGGAATTTGG + Intergenic
1019118358 6:169783841-169783863 GTGTCTCCACTTTTGGGAAGAGG - Intergenic
1019304255 7:325372-325394 CAGTCTCCACATTTGAAAATGGG + Intergenic
1019543997 7:1564304-1564326 CTGTCTCCACCTATAAAAACCGG - Intergenic
1020390638 7:7654299-7654321 CTGTATTCAGTGATGGAAATAGG + Intronic
1021061640 7:16119494-16119516 CTGTTTACATTTATTGAAATTGG - Intronic
1022171500 7:27836341-27836363 CTGTCCCCTCTGATGGAATTAGG + Intronic
1023239473 7:38128415-38128437 CTGTCTTCACTAATGTAACTGGG - Intergenic
1023365235 7:39457405-39457427 CTGTCACTACTTATGGCAAGTGG - Intronic
1023443280 7:40206176-40206198 TTGTTTCCCCTTATGGTAATAGG + Intronic
1024819013 7:53305254-53305276 ATGGCTCCAATTCTGGAAATTGG - Intergenic
1025161745 7:56667183-56667205 CTGTCTCCACAGTTGGAATTGGG + Intergenic
1026659071 7:72283165-72283187 CTGTCTCCTCTTCTGTAAAATGG + Intronic
1028647959 7:93119579-93119601 CTGTCTCCACTGAGTGACATAGG - Intergenic
1029072701 7:97913073-97913095 CAGTCTCCTCTTCTGGAAAGTGG - Intergenic
1029321357 7:99763455-99763477 CTGTATCCACATATGGACACAGG - Intronic
1030529565 7:110696023-110696045 CTGTTTCCACTTTTGAAAAGTGG - Intronic
1030695258 7:112578090-112578112 CTGTATCCACTGATGGTGATAGG - Intergenic
1031762778 7:125735268-125735290 CTGTCTCCTCTTATGGAAAGTGG - Intergenic
1036244966 8:7108225-7108247 CAGTCTCCTCTTCTGGAAAGTGG + Intergenic
1036255774 8:7205560-7205582 CAGTCTCCTCTTTTGGAAAGTGG - Intergenic
1036361711 8:8081939-8081961 CAGTCTCCTCTTTTGGAAAGTGG + Intergenic
1036889259 8:12585087-12585109 CAGTCTCCTCTTTTGGAAAGTGG - Intergenic
1036896854 8:12643251-12643273 CAGTCTCCTCTTCTGGAAAGTGG - Intergenic
1038817505 8:30920156-30920178 CTGGCTCCAATTCTGGAAATAGG + Intergenic
1041905112 8:63024089-63024111 GAGGCTCCACTTATGGAAATTGG + Exonic
1043002304 8:74773896-74773918 CTATCTCCATGTATGGCAATGGG - Intronic
1043348673 8:79331814-79331836 CAGTCTTCATTTATGTAAATTGG - Intergenic
1043653921 8:82636822-82636844 TTGTATCAACTTATGGAAATTGG - Intergenic
1044914867 8:97102352-97102374 CTCTCTCTACTTCTGGAAAAAGG - Intronic
1045000292 8:97872355-97872377 CTTTATCTACTTATGGAAAGTGG + Intronic
1045893717 8:107188469-107188491 CTGTGTCCTCTTATGGCAATGGG + Intergenic
1046769157 8:118101197-118101219 CAGTTTCCACATCTGGAAATGGG - Intronic
1047466021 8:125115193-125115215 TTGACTCCACCCATGGAAATGGG + Intronic
1047944932 8:129866737-129866759 CTCTGTCCAGTTATGAAAATGGG - Intronic
1048413455 8:134199737-134199759 CAGTCTCCTCTTCTGTAAATTGG - Intergenic
1049107759 8:140624314-140624336 CTGGCTCCACTTCTACAAATGGG - Intronic
1050191644 9:3032829-3032851 CTGTCTTCACTTTTGGACAGAGG - Intergenic
1050346227 9:4690935-4690957 CACTCTCCACTGATGGAACTTGG - Intronic
1052366523 9:27617931-27617953 ATGTCTCCAGTGAAGGAAATGGG - Intergenic
1052672823 9:31580189-31580211 ATGTCTCCACTCATGGAGCTTGG - Intergenic
1058297042 9:103322154-103322176 CTCTCTTCATTTATGGAAGTTGG - Intergenic
1061939136 9:133874727-133874749 CTGTCTCCACCTCTGGGAAGAGG - Intronic
1186282829 X:8012566-8012588 TTGTTTCCACATATGTAAATAGG + Intergenic
1187958650 X:24545839-24545861 CTGTCTCCCCTAATAGAAAGTGG - Intergenic
1189117961 X:38362851-38362873 CTGTTTCCTTTTATGGAAATTGG + Intronic
1189132487 X:38514691-38514713 CTGTCTCTAGTTATGTAATTTGG - Intronic
1189540079 X:41977975-41977997 CTTTCTTCACTGAAGGAAATAGG - Intergenic
1193904256 X:87223948-87223970 ATGTCGCCACTAATGGAGATGGG - Intergenic