ID: 1127070280

View in Genome Browser
Species Human (GRCh38)
Location 15:55282205-55282227
Sequence TGGATTGTCCACAGTACAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 82
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 77}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127070278_1127070280 17 Left 1127070278 15:55282165-55282187 CCATCTAGATGTCACTTCTTTTG 0: 1
1: 0
2: 1
3: 67
4: 278
Right 1127070280 15:55282205-55282227 TGGATTGTCCACAGTACAACTGG 0: 1
1: 0
2: 0
3: 4
4: 77

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127070280 Original CRISPR TGGATTGTCCACAGTACAAC TGG Intronic
900591239 1:3460956-3460978 TGGAGTGTCCACAGGGCACCTGG - Intronic
913492541 1:119394800-119394822 TGGAATGTGCAAAGTACAATAGG - Intergenic
922080343 1:222289686-222289708 TGGATAGTCCACAAAACATCAGG + Intergenic
1064619396 10:17199822-17199844 TGGATTCACAACAGTAGAACTGG + Intronic
1065498692 10:26356366-26356388 TGGACTGTCCACAGGACAGCTGG - Intergenic
1065718537 10:28600872-28600894 TGGATTGTCCACTGTTCTATTGG - Intronic
1065895445 10:30159292-30159314 TGGATTGTTCTAAGGACAACAGG - Intergenic
1072277485 10:93837399-93837421 TGGCTGGTCCAAAGTACAAAAGG - Intergenic
1074224961 10:111475899-111475921 TTGATTGTTCACAGTTCAAAGGG + Intergenic
1074259153 10:111834382-111834404 TGTTTTGTCCACAGTAAAAATGG - Intergenic
1086010883 11:82102050-82102072 TGGTTTGTCCACTGTTCAAGTGG + Intergenic
1086029361 11:82335159-82335181 AGGTTTGTCCACAGCACTACTGG - Intergenic
1099166778 12:79316682-79316704 TCTATCGTCCACCGTACAACTGG + Intronic
1102015165 12:109643460-109643482 TGAATTGTCCACATTACGAGGGG - Intergenic
1103028608 12:117594174-117594196 TTAATTGTCCACAGAACAAAGGG + Intronic
1106946017 13:34828489-34828511 GTGATTGTCCACAGCACAGCTGG + Intergenic
1114814208 14:25937404-25937426 TGGATTGTTTACAGTTCATCAGG - Intergenic
1114997451 14:28374035-28374057 AAGATTGTCCACATTAAAACAGG + Intergenic
1116386188 14:44333283-44333305 TGGATTTTCCTAAGTACATCTGG + Intergenic
1116982062 14:51182132-51182154 TGAATTGTTCTCATTACAACTGG - Intergenic
1120596272 14:86441355-86441377 TCCATTGTCCACAGTATATCTGG - Intergenic
1124943809 15:34244276-34244298 TGGATTATCCTAAGAACAACTGG - Intronic
1126028418 15:44472322-44472344 TTGATTGTCCTCAAGACAACTGG - Intronic
1126835486 15:52659937-52659959 AGGATTGGACACAGGACAACAGG + Intronic
1127070280 15:55282205-55282227 TGGATTGTCCACAGTACAACTGG + Intronic
1127979628 15:64024995-64025017 TGGATTAGACACAGGACAACTGG + Intronic
1147506826 17:41026669-41026691 AGGACTGTCCACAGTAGGACGGG + Exonic
1147507109 17:41029760-41029782 AGGACTGTCCACAGTAGGACGGG + Exonic
1147590489 17:41680094-41680116 GAGATTGTCCACAGTAGCACTGG + Intergenic
1150221224 17:63496950-63496972 TGGGCTGGCCGCAGTACAACTGG + Exonic
1153490216 18:5639685-5639707 TGGATTGTCCCCAGTGGAAGAGG + Intergenic
1153704391 18:7730546-7730568 TGGATTATCCACAGTGTAGCTGG + Intronic
1156550058 18:38006196-38006218 TGGGTTGTCCACAGAGAAACTGG + Intergenic
1157709448 18:49839966-49839988 TGTATTTGACACAGTACAACAGG - Intronic
1165700070 19:37930688-37930710 TGGCTTGCCCAAAGTAAAACAGG - Intronic
1165853734 19:38867374-38867396 GGGACTGTCCACAGGACAACTGG + Intergenic
1168451867 19:56472823-56472845 TGGATTTTCTACAGTACAGGGGG + Intronic
925779471 2:7369011-7369033 AGGAATGTCCACAGCAGAACCGG + Intergenic
926126057 2:10272530-10272552 TGGATGGGCCCCAGTCCAACAGG + Intergenic
926564527 2:14454968-14454990 TGGGTTGTTCACAGGACCACGGG + Intergenic
928587116 2:32771313-32771335 TGGTTTTTCTACAGTGCAACAGG - Intronic
934766866 2:96884596-96884618 TGGTGTGTCCACAGGACACCAGG + Intronic
939588685 2:144036068-144036090 TGTATTGTATACAGTACAAAAGG - Intronic
943934381 2:193896419-193896441 TGAATTTTCCCCATTACAACTGG - Intergenic
1169976758 20:11338012-11338034 TGGATTCTCCAGAATACATCAGG + Intergenic
1172597518 20:36159892-36159914 TGGACTATCCACATTACAGCTGG - Intronic
1181084591 22:20433682-20433704 TGTATTTTCCACAATAAAACTGG + Intronic
1181719830 22:24765030-24765052 TAAGTTGTCCACAGGACAACTGG - Intronic
955163696 3:56490031-56490053 TGGATTGTGCACAGGACCAGGGG - Intergenic
956614292 3:71155924-71155946 TTGATTGTCCAAAGCACAAGGGG - Intronic
960392910 3:117101137-117101159 TAGATTGTCCCCAGGAAAACTGG - Intronic
961148191 3:124613027-124613049 TGGAATGTCACCAGTACTACAGG - Intronic
963483792 3:145910415-145910437 TGGAGTATACACAGTACATCTGG + Intergenic
967065026 3:185907547-185907569 TGGATTCTCCACAGGATGACTGG + Intergenic
969956913 4:10900071-10900093 CTAATTGTCCACAGGACAACAGG - Intergenic
972269426 4:37496018-37496040 TGGATTGTCTATAGAACACCAGG - Intronic
972410947 4:38793988-38794010 TGGGTTGTCCACAGTAGAAATGG + Intronic
978629910 4:110732434-110732456 TGAATTGTCCACATTACATAGGG - Intergenic
980660408 4:135850239-135850261 TTTATTGTCCACTGGACAACTGG - Intergenic
986303288 5:6495463-6495485 GGGCTTGTCCACAGTAGGACAGG + Intergenic
996615873 5:125440926-125440948 TGGTTTTTCCACAGTTCCACTGG - Intergenic
996626969 5:125581723-125581745 TGCTTTCACCACAGTACAACTGG - Intergenic
1000013818 5:157259361-157259383 TGGATTTTCGACAGTGCAAGGGG - Intergenic
1001134251 5:169089438-169089460 TAGCTTGTCCACAGGAGAACAGG - Intronic
1004341243 6:14809395-14809417 TAGATTGTCCACAGAATAGCTGG - Intergenic
1013035047 6:106373800-106373822 TTCATTTTCCAAAGTACAACTGG + Intergenic
1016534245 6:145092765-145092787 TGGATTGTGCAAAGCCCAACAGG - Intergenic
1023512890 7:40971752-40971774 TGGGTTGTCGTCAGTACCACAGG + Intergenic
1032899142 7:136286948-136286970 AGGATTTTCCACTGTAGAACTGG + Intergenic
1037090603 8:14911923-14911945 TGGATTTTGCACAGGTCAACAGG + Intronic
1041739725 8:61145458-61145480 TGAAATGTAAACAGTACAACGGG - Intronic
1043331512 8:79122930-79122952 TGGATGGTCCTCAGACCAACAGG + Intergenic
1046327569 8:112670056-112670078 AGGTATGTCCACAGTACAAGGGG + Intronic
1047105701 8:121728237-121728259 TGTATTGTCCATATTACTACCGG + Intergenic
1051772982 9:20599772-20599794 TGGACTGTCCTCAGCAAAACAGG + Intronic
1059284064 9:113157772-113157794 TGGAGTGTCCACAGTCCTGCTGG + Exonic
1187738295 X:22326955-22326977 TGTATTGTCCAAATCACAACAGG - Intergenic
1191576069 X:62707611-62707633 TACTTTGTCCACAATACAACAGG + Intergenic
1191931944 X:66383288-66383310 TGGATGGTCTCCAGTAGAACAGG - Intergenic
1198137164 X:133764729-133764751 TGGTGTGTCCACAGTAAAACGGG - Intronic
1199005785 X:142694186-142694208 CAGATTAGCCACAGTACAACAGG + Intergenic
1199201856 X:145100019-145100041 TGGACAGTCTTCAGTACAACTGG + Intergenic